Term IRI Term label Parent term IRI Parent term label Alternative term Definition http://purl.obolibrary.org/obo/IAO_8000006 subset ontology module http://purl.obolibrary.org/obo/IAO_8000000 ontology module subset ontology An ontology module that is extracted from a main ontology module and includes only a subset of entities or axioms. http://purl.obolibrary.org/obo/IAO_0000102 data about an ontology part http://purl.obolibrary.org/obo/IAO_0000027 data item ontology metadata Data about an ontology part is a data item about a part of an ontology, for example a term http://purl.obolibrary.org/obo/SO_0001026 genome http://purl.obolibrary.org/obo/GENO_0000660 genomic feature set 'genome sequence' A collection of sequence features (typically a collection of chromosomes) that covers the sum genetic material within a cell or virion (where 'genetic material' refers to any nucleic acid that is part of a cell or virion and has been inherited from an ancestor cell or virion, and/or can be replicated and inherited by its progeny) http://purl.obolibrary.org/obo/GENO_0000000 genomic genotype (sex-agnostic) http://purl.obolibrary.org/obo/GENO_0000899 genomic genotype sex-agnostic intrinsic genotype A genomic genotype that does not specify the sex determining chromosomal features of its bearer (i.e. does not indicate the background sex chromosome complement) http://purl.obolibrary.org/obo/GENO_0000002 variant allele http://purl.obolibrary.org/obo/GENO_0000512 allele alternate allele An allele that varies in it sequence from what is considered the reference or canonical sequence at that location. http://purl.obolibrary.org/obo/GENO_0000010 background genome http://purl.obolibrary.org/obo/GENO_0000914 reference genome genomic background A reference genome that represents the sequence of a genome from which a variant genome is derived (through the introduction of sequence alterations). http://purl.obolibrary.org/obo/GENO_0000030 variant single locus complement http://purl.obolibrary.org/obo/GENO_0000516 single locus complement variant allelic complement A single locus complement in which at least one member allele is considered variant, and/or the total number of features in the complement deviates from the normal poloidy of the reference genome (e.g. trisomy 13). http://purl.obolibrary.org/obo/GENO_0000108 material genome http://purl.obolibrary.org/obo/BFO_0000040 material entity physical genome A material entity that represents all genetic material in a cell or virion. The material genome is typically molecular aggregate of all the chromosomal DNA and epi-chromosomal DNA that represents all sequences that are heritable by progeny of a cell or virion. http://purl.obolibrary.org/obo/GENO_0000111 human population http://purl.obolibrary.org/obo/OBI_0000181 population homo sapiens population a population of homo sapiens grouped together in virtue of their sharing some commonality (either an inherent attribute or an externally assigned role) http://purl.obolibrary.org/obo/GENO_0000112 strain or breed http://purl.obolibrary.org/obo/GENO_0000113 taxonomic group organism strain or breed A maximal collection of organisms of a single species that have been bred or experimentally manipulated with the goal of being genetically identical. http://purl.obolibrary.org/obo/GENO_0000133 zygosity http://purl.obolibrary.org/obo/GENO_0000875 allelic state allelic state An allelic state that describes the degree of similarity between features in a 'single locus complement', within the genome of a cell or organism (i.e., whether the alleles or haplotypes that reside at the same location on paired chromosomes are the same or different). http://purl.obolibrary.org/obo/GENO_0000141 inheritance pattern http://purl.obolibrary.org/obo/BFO_0000016 disposition mode of inheritance The pattern in which a genetic trait or condition is passed from one generation to the next, as determined by genetic interactions between alleles of the causal gene, and interactions between these alleles and the environment. http://purl.obolibrary.org/obo/GENO_0000144 complete autosomal dominant inheritance http://purl.obolibrary.org/obo/GENO_0000147 autosomal dominant inheritance pure dominant inheritance An autosomal dominant inheritance pattern wherein the trait associated with one allele completely masks the trait associated with a different allele found at that locus. http://purl.obolibrary.org/obo/GENO_0000145 incomplete autosomal dominant inheritance http://purl.obolibrary.org/obo/GENO_0000147 autosomal dominant inheritance semi-dominant autosomal inheritance An autosomal dominant inheritance pattern wherein the trait expressed in a heterozygous individual is intermediate between the trait expressed in individuals homozygous for either allele in the heterozygous locus. http://purl.obolibrary.org/obo/GENO_0000147 autosomal dominant inheritance http://purl.obolibrary.org/obo/GENO_0000934 autosomal inheritance vertical inheritance An inheritance pattern wherein a trait caused by alleles of an autosomal gene manifests in heterozygotes. http://purl.obolibrary.org/obo/GENO_0000338 gained aneusomic chromosome http://purl.obolibrary.org/obo/GENO_0000346 aneusomic chromosome duplicate chromosome A complete chromosome that has been abnormally duplicated in a genome, typically as the result of a meiotic non-disjunction event or unbalanced translocation http://purl.obolibrary.org/obo/GENO_0000339 lost aneusomic chromosome http://purl.obolibrary.org/obo/GENO_0000346 aneusomic chromosome absent aneusomic chromosome A 'deletion' resulting from the loss of a complete chromosome, typically as the result of a meiotic non-disjunction event or unbalanced translocation. http://purl.obolibrary.org/obo/GENO_0000343 aneusomic chromosomal part http://purl.obolibrary.org/obo/SO_0001059 sequence_alteration partial aneusomic chromosomal element A large deletion or terminal addition of part of some non-homologous chromsosome, as the result of an unbalanced translocation. http://purl.obolibrary.org/obo/GENO_0000344 gained aneusomic chromosomal segment http://purl.obolibrary.org/obo/GENO_0000343 aneusomic chromosomal part translocated duplicate chromosomal segment A part of some non-homologous chromosome that has been gained as the result of an unbalanced translocation event. http://purl.obolibrary.org/obo/GENO_0000345 lost aneusomic chromosomal segment http://purl.obolibrary.org/obo/GENO_0000343 aneusomic chromosomal part truncated chromosome terminus A deletion of a terminal portion of a chromosome resulting from an unbalanced translocation to another chromosome. http://purl.obolibrary.org/obo/GENO_0000346 aneusomic chromosome http://purl.obolibrary.org/obo/SO_0001059 sequence_alteration complete aneusomic chromosome A complete chromosome that has been abnormally duplicated, or the absense of a chromosome that has been lost, typically as the result of a non-disjunction event or unbalanced translocation http://purl.obolibrary.org/obo/GENO_0000402 compound heterozygous http://purl.obolibrary.org/obo/GENO_0000135 heterozygous trans-heterozygous A heterozygous quality inhering in a single locus complement comprised of two different varaint alleles and no wild type locus. (e.g.fgf8a/fgf8a) http://purl.obolibrary.org/obo/GENO_0000494 extrachromosomal replicon http://purl.obolibrary.org/obo/GENO_0000481 genomic feature episomal replicon A genetic feature that is not part of the chromosomal genome of a cell or virion, but rather a stable and heritable element that is replilcated and passed on to progeny (e.g. a replicative plasmid or transposon) http://purl.obolibrary.org/obo/GENO_0000498 major polymorphic allele http://purl.obolibrary.org/obo/GENO_0000497 polymorphic allele major allele A polymorphic allele that is present at the highest frequency relative to other polymorphic variants at the same genomic location. http://purl.obolibrary.org/obo/GENO_0000499 minor polymorphic allele http://purl.obolibrary.org/obo/GENO_0000497 polymorphic allele minor allele A polymorphic allele that is not present at the highest frequency among all fixed variants at the locus (i.e. not the major polymorphic allele at a given location). http://purl.obolibrary.org/obo/GENO_0000500 ancestral polymorphic allele http://purl.obolibrary.org/obo/GENO_0000497 polymorphic allele ancestral allele A polymorphic allele that is determined from the sequence of a recent ancestor in a phylogentic tree. http://purl.obolibrary.org/obo/GENO_0000501 wild-type allele http://purl.obolibrary.org/obo/GENO_0000512 allele wild-type allele An allele representing a highly common varaint (typically >99% in a population), that typically exhibits canonical function, and against which rare and/or non-functional mutant alleles are often compared. http://purl.obolibrary.org/obo/GENO_0000506 transiently-expressed transgene http://purl.obolibrary.org/obo/GENO_0000529 expression-variant gene experimentally-expressed transgene A transgene that is delivered as part of a DNA expression construct into a cell or organism in order to transiently express a specified product (i.e. it has not integrated into the host genome). http://purl.obolibrary.org/obo/GENO_0000512 allele http://purl.obolibrary.org/obo/GENO_0000481 genomic feature variable feature One of a set of sequence features known to exist at a particular genomic location. http://purl.obolibrary.org/obo/GENO_0000516 single locus complement http://purl.obolibrary.org/obo/GENO_0000660 genomic feature set homologous allele complement A set representing the complement of all sequence features occupying a particular genomic location across all homologous chromosomes in the genome of a single organism. http://purl.obolibrary.org/obo/GENO_0000524 extrinsic genotype http://purl.obolibrary.org/obo/GENO_0000536 genotype expression genotype A specification of the known state of gene expression across a genome, and how it varies from some baseline/reference state. http://purl.obolibrary.org/obo/GENO_0000528 transiently-expressed transgene complement http://purl.obolibrary.org/obo/GENO_0000715 qualified genomic feature set experimental transgene complement The set of all transgenes trransiently expressed in a biological system in the context of a given experiment. http://purl.obolibrary.org/obo/GENO_0000529 expression-variant gene http://purl.obolibrary.org/obo/GENO_0000737 expression-qualified sequence feature expression allele A gene altered in its expression level relative to some baseline of normal expression in the system under investigation (e.g. a cell line or model organism). http://purl.obolibrary.org/obo/GENO_0000534 reagent-targeted gene subregion http://purl.obolibrary.org/obo/GENO_0000737 expression-qualified sequence feature targeted gene segment A region within a gene that is specifically targeted by a gene knockdown reagent, typically in virtue of bearing sequence complementary to the reagent. http://purl.obolibrary.org/obo/GENO_0000611 genomic background http://purl.obolibrary.org/obo/GENO_0000899 genomic genotype background genotype A genomic genotype that specifies the baseline sequence of a genome from which a variant genome is derived (through the introduction of sequence alterations). http://purl.obolibrary.org/obo/GENO_0000628 short chromosome arm http://purl.obolibrary.org/obo/SO_0000105 chromosome arm stalk A chromosome arm that is the shorter of the two arms of a given chromosome. http://purl.obolibrary.org/obo/GENO_0000629 long chromosome arm http://purl.obolibrary.org/obo/SO_0000105 chromosome arm q-arm A chromosome arm that is the longer of the two arms of a given chromosome. http://purl.obolibrary.org/obo/GENO_0000638 expressed transgene region http://purl.obolibrary.org/obo/GENO_0000460 transgene part coding transgene feature A transgene part whose sequence is expressed in a gene product through transcription and/or translation. http://purl.obolibrary.org/obo/GENO_0000645 genomic genotype (sex-qualified) http://purl.obolibrary.org/obo/GENO_0000899 genomic genotype sex-qualified intrinsic genotype A genomic genotype where the genomic background specifies a male or female sex chromosome complement. http://purl.obolibrary.org/obo/GENO_0000649 unspecified genomic background http://purl.obolibrary.org/obo/GENO_0000611 genomic background unspecified background genotype A background genotype whose sequence or identity is not known or specified. http://purl.obolibrary.org/obo/GENO_0000660 genomic feature set http://purl.obolibrary.org/obo/GENO_0000897 genomic entity genomic locus complement A set of genomic features (i.e. sequence features that are of genomic origin). http://purl.obolibrary.org/obo/GENO_0000666 gene part http://purl.obolibrary.org/obo/GENO_0000481 genomic feature defined gene part A genomic feature that is part of a gene, and delineated by some functional or structural function or role it serves (e.g.a promoter element, coding region, etc). http://purl.obolibrary.org/obo/GENO_0000681 novel extrachromosomal replicon http://purl.obolibrary.org/obo/GENO_0000684 novel replicon transgenic extrachromosomal replicon An extrachromosomal replicon that is variant in a genome in virtue of its being a novel addition to the genome - i.e. it is not present in the reference for the genome in which it is found. http://purl.obolibrary.org/obo/GENO_0000701 sequence feature or set http://purl.obolibrary.org/obo/BFO_0000031 generically dependent continuant sequence feature or collection A sequence feature or a set of such features. http://purl.obolibrary.org/obo/GENO_0000702 biological sequence http://purl.obolibrary.org/obo/GENO_0000921 biological sequence or set state A linear ordering of units representing monomers of a biological macromolecule (e.g. nucleotides in DNA and RNA, amino acids in polypeptides). http://purl.obolibrary.org/obo/GENO_0000773 variation attribute http://purl.obolibrary.org/obo/GENO_0000788 sequence feature attribute allele attribute An attribute describing a type of variation inhering in a sequence feature or collection. http://purl.obolibrary.org/obo/GENO_0000823 allelic genotype http://purl.obolibrary.org/obo/GENO_0000897 genomic entity single locus genotype A genotype that specifies the 'allelic state' at a particular location in the genome - i.e. the set of alleles present at this locus across all homologous chromosomes. http://purl.obolibrary.org/obo/GENO_0000856 engineered genetic construct http://purl.obolibrary.org/obo/SO_0000804 engineered_region engineered_genetic_vector An engineered region that is used to transfer foreign genetic material into a host cell. http://purl.obolibrary.org/obo/GENO_0000861 extra-chromosomal transgene http://purl.obolibrary.org/obo/SO_0000902 transgene non-integrated transgene A transgene that is not chromosomally integrated in the host genome, but instead exists as part of an extra-chromosomal construct. http://purl.obolibrary.org/obo/SO_0001742 copy_number_gain http://purl.obolibrary.org/obo/SO_0001019 copy_number_variation gain A sequence alteration whereby the copy number of a given regions is greater than the reference sequence. http://purl.obolibrary.org/obo/SO_0001743 copy_number_loss http://purl.obolibrary.org/obo/SO_0001019 copy_number_variation loss A sequence alteration whereby the copy number of a given region is less than the reference sequence. http://purl.obolibrary.org/obo/SO_0001744 UPD http://purl.obolibrary.org/obo/SO_0001059 sequence_alteration uniparental disomy Uniparental disomy is a sequence_alteration where a diploid individual receives two copies for all or part of a chromosome from one parent and no copies of the same chromosome or region from the other parent. http://purl.obolibrary.org/obo/SO_0001745 maternal_uniparental_disomy http://purl.obolibrary.org/obo/SO_0001744 UPD maternal uniparental disomy Uniparental disomy is a sequence_alteration where a diploid individual receives two copies for all or part of a chromosome from the mother and no copies of the same chromosome or region from the father. http://purl.obolibrary.org/obo/SO_0001746 paternal_uniparental_disomy http://purl.obolibrary.org/obo/SO_0001744 UPD paternal uniparental disomy Uniparental disomy is a sequence_alteration where a diploid individual receives two copies for all or part of a chromosome from the father and no copies of the same chromosome or region from the mother. http://purl.obolibrary.org/obo/SO_0001784 complex_structural_alteration http://purl.obolibrary.org/obo/SO_0001785 structural_alteration complex A structural sequence alteration where there are multiple equally plausible explanations for the change. http://purl.obolibrary.org/obo/WBPhenotype_0000886 worm phenotype http://purl.obolibrary.org/obo/UPHENO_0001001 Phenotype c. elegans phenotype Animals exhibit variations compared to a given control. http://purl.obolibrary.org/obo/GENO_0000888 germline allele origin http://purl.obolibrary.org/obo/GENO_0000974 inherited allele origin parentally inherited Describes an allele that is inherited from a parent in virtue of the allele being present in the germline of one of the parents. http://purl.obolibrary.org/obo/GENO_0000889 undetermined inheritance http://purl.obolibrary.org/obo/GENO_0000141 inheritance pattern unknown inheritance An inheritance pattern that is not determined or not known. http://purl.obolibrary.org/obo/SO_0000830 chromosome part http://purl.obolibrary.org/obo/GENO_0000481 genomic feature gross chromosomal part An extended region of sequence corresponding to a defined feature that is a proper part of a chromosome, e.g. a chromosomal 'arm', 'region', or 'band'. http://purl.obolibrary.org/obo/GENO_0000945 incomplete Z-linked dominant inheritance http://purl.obolibrary.org/obo/GENO_0000943 Z-linked dominant inheritance semi-dominant Z-linked inheritance A Z-linked dominant inheritance pattern wherein the trait expressed in a heterozygous individual is intermediate between the trait expressed in individuals homozygous for either allele in the heterozygous locus. http://purl.obolibrary.org/obo/GENO_0000941 Y-linked inheritance http://purl.obolibrary.org/obo/GENO_0000935 allosomal inheritance holandric inheritance An inheritance pattern wherein the trait is determined by alleles of a single causal gene on a Y-chromosome. http://purl.obolibrary.org/obo/GENO_0000935 allosomal inheritance http://purl.obolibrary.org/obo/GENO_0000933 monogenic inheritance gonosomal inheritance An inheritance pattern wherein the trait is determined by alleles of a single causal gene on a sex chromosome. http://purl.obolibrary.org/obo/GENO_0000938 incomplete X-linked dominant inheritance http://purl.obolibrary.org/obo/GENO_0000146 X-linked dominant inheritance semi-dominant X-linked inheritance An X-linked dominant inheritance pattern wherein the trait expressed in a heterozygous individual is intermediate between the trait expressed in individuals homozygous for either allele in the heterozygous locus. http://purl.obolibrary.org/obo/GENO_0000929 multifactorial inheritance http://purl.obolibrary.org/obo/GENO_0000141 inheritance pattern multigenic inheritance An inheritance pattern that depends on a mixture of major and minor genetic determinants (i.e. alleles of more than one contributing genes), possibly together with environmental factors. http://purl.obolibrary.org/obo/SO_0000771 QTL http://purl.obolibrary.org/obo/GENO_0000481 genomic feature quantitative trait locus A quantitative trait locus (QTL) is a polymorphic locus which contains alleles that differentially affect the expression of a continuously distributed phenotypic trait. Usually it is a marker described by statistical association to quantitative variation in the particular phenotypic trait that is thought to be controlled by the cumulative action of alleles at multiple loci. http://purl.obolibrary.org/obo/GENO_0000872 genomic sequence set http://purl.obolibrary.org/obo/GENO_0000922 biological sequence set copy number complement A set of genomic sequences (a biological sequence that is of genomic origin). http://purl.obolibrary.org/obo/GENO_0000921 biological sequence or set http://purl.obolibrary.org/obo/BFO_0000031 generically dependent continuant biological sequence or collection A biolocical sequence, or set of such sequences. http://purl.obolibrary.org/obo/GENO_0000933 monogenic inheritance http://purl.obolibrary.org/obo/GENO_0000141 inheritance pattern single-gene inheritance An inheritance pattern wherein the trait is determined by alleles of a single causal gene, possibly together with environmental factors. http://purl.obolibrary.org/obo/SO_0000159 deletion http://purl.obolibrary.org/obo/SO_0001059 sequence_alteration nucleotide_deletion The point at which one or more contiguous nucleotides were excised. http://purl.obolibrary.org/obo/SO_0000199 translocation http://purl.obolibrary.org/obo/SO_0001059 sequence_alteration translocated sequence A region of nucleotide sequence that has translocated to a new position. http://purl.obolibrary.org/obo/SO_0000667 insertion http://purl.obolibrary.org/obo/SO_0001059 sequence_alteration nucleotide_insertion The sequence of one or more nucleotides added between two adjacent nucleotides in the sequence. http://purl.obolibrary.org/obo/SO_0000694 SNP http://purl.obolibrary.org/obo/SO_0001483 SNV single nucleotide polymorphism SNPs are single base pair positions in genomic DNA at which different sequence alternatives exist in normal individuals in some population(s), wherein the least frequent variant has an abundance of 1% or greater. http://purl.obolibrary.org/obo/SO_0001013 MNP http://purl.obolibrary.org/obo/SO_1000002 substitution multiple nucleotide polymorphism A multiple nucleotide polymorphism with alleles of common length > 1, for example AAA/TTT. http://purl.obolibrary.org/obo/SO_0001019 copy_number_variation http://purl.obolibrary.org/obo/SO_0001059 sequence_alteration copy number polymorphism A variation that increases or decreases the copy number of a given region. http://purl.obolibrary.org/obo/SO_0001059 sequence_alteration http://purl.obolibrary.org/obo/GENO_0000512 allele sequence variation A sequence_alteration is a sequence_feature whose extent is the deviation from another sequence. http://purl.obolibrary.org/obo/SO_0001218 transgenic_insertion http://purl.obolibrary.org/obo/SO_0000667 insertion transgenic insertion An insertion that derives from another organism, via the use of recombinant DNA technology. http://purl.obolibrary.org/obo/SO_0001483 SNV http://purl.obolibrary.org/obo/SO_1000002 substitution single nucleotide variant SNVs are single base pair positions in genomic DNA at which different sequence alternatives exist. http://purl.obolibrary.org/obo/SO_1000005 complex_substitution http://purl.obolibrary.org/obo/SO_1000002 substitution complex substitution When no simple or well defined DNA mutation event describes the observed DNA change, the keyword \"complex\" should be used. Usually there are multiple equally plausible explanations for the change. http://purl.obolibrary.org/obo/SO_1000008 point_mutation http://purl.obolibrary.org/obo/SO_0001483 SNV point mutation A single nucleotide change which has occurred at the same position of a corresponding nucleotide in a reference sequence. http://purl.obolibrary.org/obo/SO_1000010 pyrimidine_transition http://purl.obolibrary.org/obo/SO_1000009 transition pyrimidine transition A substitution of a pyrimidine, C or T, for another pyrimidine. http://purl.obolibrary.org/obo/SO_1000011 C_to_T_transition http://purl.obolibrary.org/obo/SO_1000010 pyrimidine_transition C to T transition A transition of a cytidine to a thymine. http://purl.obolibrary.org/obo/SO_1000012 C_to_T_transition_at_pCpG_site http://purl.obolibrary.org/obo/SO_1000011 C_to_T_transition C to T transition at pCpG site The transition of cytidine to thymine occurring at a pCpG site as a consequence of the spontaneous deamination of 5'-methylcytidine. http://purl.obolibrary.org/obo/SO_1000014 purine_transition http://purl.obolibrary.org/obo/SO_1000009 transition purine transition A substitution of a purine, A or G, for another purine. http://purl.obolibrary.org/obo/SO_1000015 A_to_G_transition http://purl.obolibrary.org/obo/SO_1000014 purine_transition A to G transition A transition of an adenine to a guanine. http://purl.obolibrary.org/obo/SO_1000016 G_to_A_transition http://purl.obolibrary.org/obo/SO_1000014 purine_transition G to A transition A transition of a guanine to an adenine. http://purl.obolibrary.org/obo/SO_1000018 pyrimidine_to_purine_transversion http://purl.obolibrary.org/obo/SO_1000017 transversion pyrimidine to purine transversion Change of a pyrimidine nucleotide, C or T, into a purine nucleotide, A or G. http://purl.obolibrary.org/obo/SO_1000019 C_to_A_transversion http://purl.obolibrary.org/obo/SO_1000018 pyrimidine_to_purine_transversion C to A transversion A transversion from cytidine to adenine. http://purl.obolibrary.org/obo/SO_1000021 T_to_A_transversion http://purl.obolibrary.org/obo/SO_1000018 pyrimidine_to_purine_transversion T to A transversion A transversion from T to A. http://purl.obolibrary.org/obo/SO_1000022 T_to_G_transversion http://purl.obolibrary.org/obo/SO_1000018 pyrimidine_to_purine_transversion T to G transversion A transversion from T to G. http://purl.obolibrary.org/obo/SO_1000023 purine_to_pyrimidine_transversion http://purl.obolibrary.org/obo/SO_1000017 transversion purine to pyrimidine transversion Change of a purine nucleotide, A or G , into a pyrimidine nucleotide C or T. http://purl.obolibrary.org/obo/SO_1000024 A_to_C_transversion http://purl.obolibrary.org/obo/SO_1000023 purine_to_pyrimidine_transversion A to C transversion A transversion from adenine to cytidine. http://purl.obolibrary.org/obo/SO_1000025 A_to_T_transversion http://purl.obolibrary.org/obo/SO_1000023 purine_to_pyrimidine_transversion A to T transversion A transversion from adenine to thymine. http://purl.obolibrary.org/obo/SO_1000026 G_to_C_transversion http://purl.obolibrary.org/obo/SO_1000023 purine_to_pyrimidine_transversion G to C transversion A transversion from guanine to cytidine. http://purl.obolibrary.org/obo/SO_1000027 G_to_T_transversion http://purl.obolibrary.org/obo/SO_1000023 purine_to_pyrimidine_transversion G to T transversion A transversion from guanine to thymine. http://purl.obolibrary.org/obo/SO_1000035 duplication http://purl.obolibrary.org/obo/SO_0000667 insertion nucleotide_duplication One or more nucleotides are added between two adjacent nucleotides in the sequence; the inserted sequence derives from, or is identical in sequence to, nucleotides adjacent to insertion point. http://purl.obolibrary.org/obo/SO_1000036 inversion http://purl.obolibrary.org/obo/SO_0001059 sequence_alteration inversion A continuous nucleotide sequence is inverted in the same position. http://purl.obolibrary.org/obo/SO_1000039 direct_tandem_duplication http://purl.obolibrary.org/obo/SO_1000173 tandem_duplication direct tandem duplication A tandem duplication where the individual regions are in the same orientation. http://purl.obolibrary.org/obo/SO_1000040 inverted_tandem_duplication http://purl.obolibrary.org/obo/SO_1000173 tandem_duplication mirror duplication A tandem duplication where the individual regions are not in the same orientation. http://purl.obolibrary.org/obo/SO_1000173 tandem_duplication http://purl.obolibrary.org/obo/SO_1000035 duplication tandem duplication A duplication consisting of 2 identical adjacent regions. http://purl.obolibrary.org/obo/GENO_0000877 allele origin http://purl.obolibrary.org/obo/GENO_0000788 sequence feature attribute variant origin A quality inhering in an allele that describes its genetic origin (how it came to be part of a cell's genome), i.e. whether it occurred de novo through some spontaneous mutation event, or was inherited from a parent. http://purl.obolibrary.org/obo/GENO_0000878 maternal allele origin http://purl.obolibrary.org/obo/GENO_0000888 germline allele origin maternally inherited Describes an allele that is inherited from a female parent in virtue of the allele being present in the mother's egg. http://purl.obolibrary.org/obo/GENO_0000879 paternal allele origin http://purl.obolibrary.org/obo/GENO_0000888 germline allele origin paternally inherited Describes an allele that is inherited from a male parent in virtue of the allele being present in the father's sperm. http://purl.obolibrary.org/obo/GENO_0000882 somatic allele origin http://purl.obolibrary.org/obo/GENO_0000877 allele origin acquired Describes an allele that result from some spontaneous mutation event in a somatic cell after fertilization, and thus are not present in every cell in the body. http://purl.obolibrary.org/obo/GENO_0000017 reference sequence http://purl.obolibrary.org/obo/GENO_0000702 biological sequence reference sequence A sequence that serves as a standard against which other sequences at the same location are compared. http://purl.obolibrary.org/obo/GENO_0000963 functional copy complement http://purl.obolibrary.org/obo/GENO_0000872 genomic sequence set functional genetic dosage A set representing the complement of all functional versions of a specified sequence (typically that of a gene) in a particular genome. http://purl.obolibrary.org/obo/IAO_8000002 editors ontology module http://purl.obolibrary.org/obo/IAO_8000000 ontology module source ontology module An ontology module that is intended to be directly edited, typically managed in source control, and typically not intended for direct consumption by end-users. http://purl.obolibrary.org/obo/IAO_8000005 import ontology module http://purl.obolibrary.org/obo/IAO_8000006 subset ontology module import file A subset ontology module that is intended to be imported from another ontology. http://purl.obolibrary.org/obo/IAO_8000009 single layer subset ontology module http://purl.obolibrary.org/obo/IAO_8000006 subset ontology module ribbon subset A subset ontology that is largely comprised of a single layer or strata in an ontology class hierarchy. The purpose is typically for rolling up for visualization. The classes in the layer need not be disjoint. http://purl.obolibrary.org/obo/IAO_8000010 exclusion subset ontology module http://purl.obolibrary.org/obo/IAO_8000006 subset ontology module antislim A subset of an ontology that is intended to be excluded for some purpose. For example, a blacklist of classes. http://purl.obolibrary.org/obo/IAO_8000011 external import ontology module http://purl.obolibrary.org/obo/IAO_8000005 import ontology module external import An imported ontology module that is derived from an external ontology. Derivation methods include the OWLAPI SLME approach. http://purl.obolibrary.org/obo/IAO_8000012 species subset ontology module http://purl.obolibrary.org/obo/IAO_8000006 subset ontology module taxon subset A subset ontology that is crafted to either include or exclude a taxonomic grouping of species. http://purl.obolibrary.org/obo/GENO_0000899 genomic genotype http://purl.obolibrary.org/obo/GENO_0000897 genomic entity complete genotype A genotype that describes the total variation in heritable genomic sequence of a cell or organism, typically in terms of alterations from some reference or background genotype. http://purl.obolibrary.org/obo/GENO_0000902 genomic feature location http://purl.obolibrary.org/obo/GENO_0000815 sequence feature location genomic location The location of a sequence feature in a genome, defined by its start and end position on some reference genomic coordinate system http://purl.obolibrary.org/obo/GENO_0000904 organismal entity http://purl.obolibrary.org/obo/BFO_0000040 material entity A material entity that is an organism, derived from an organism, or composed of organisms (e.g. a cell line, biosample, tissue culture, population, etc). http://purl.obolibrary.org/obo/GENO_0000907 gene product http://purl.obolibrary.org/obo/SO_0000110 sequence_feature The molecular product resulting from transcription of a single gene (either a protein or RNA molecule) http://purl.obolibrary.org/obo/GENO_0000914 reference genome http://purl.obolibrary.org/obo/SO_0001026 genome A genome whose sequence is identical to that of a genome sequence considered to be the reference. http://purl.obolibrary.org/obo/BFO_0000004 independent continuant http://purl.obolibrary.org/obo/BFO_0000002 continuant b is an independent continuant = Def. b is a continuant which is such that there is no c and no t such that b s-depends_on c at t. (axiom label in BFO2 Reference: [017-002]) http://purl.obolibrary.org/obo/BFO_0000015 process http://purl.obolibrary.org/obo/BFO_0000003 occurrent p is a process = Def. p is an occurrent that has temporal proper parts and for some time t, p s-depends_on some material entity at t. (axiom label in BFO2 Reference: [083-003]) http://purl.obolibrary.org/obo/BFO_0000020 specifically dependent continuant http://purl.obolibrary.org/obo/BFO_0000002 continuant b is a relational specifically dependent continuant = Def. b is a specifically dependent continuant and there are n > 1 independent continuants c1, … cn which are not spatial regions are such that for all 1 i < j n, ci and cj share no common parts, are such that for each 1 i n, b s-depends_on ci at every time t during the course of b’s existence (axiom label in BFO2 Reference: [131-004]) http://purl.obolibrary.org/obo/BFO_0000031 generically dependent continuant http://purl.obolibrary.org/obo/BFO_0000002 continuant b is a generically dependent continuant = Def. b is a continuant that g-depends_on one or more other entities. (axiom label in BFO2 Reference: [074-001]) http://purl.obolibrary.org/obo/CLO_0000031 cell line http://purl.obolibrary.org/obo/GENO_0000904 organismal entity A cultured cell population that represents a genetically stable and homogenous population of cultured cells that shares a common propagation history (i.e. has been successively passaged together in culture). http://purl.obolibrary.org/obo/IAO_0000030 information content entity http://purl.obolibrary.org/obo/BFO_0000031 generically dependent continuant an information content entity is an entity that is generically dependent on some artifact and stands in relation of aboutness to some entity http://purl.obolibrary.org/obo/IAO_0000078 curation status specification http://purl.obolibrary.org/obo/IAO_0000102 data about an ontology part The curation status of the term. The allowed values come from an enumerated list of predefined terms. See the specification of these instances for more detailed definitions of each enumerated value. http://purl.obolibrary.org/obo/IAO_0000225 obsolescence reason specification http://purl.obolibrary.org/obo/IAO_0000102 data about an ontology part The reason for which a term has been deprecated. The allowed values come from an enumerated list of predefined terms. See the specification of these instances for more detailed definitions of each enumerated value. http://purl.obolibrary.org/obo/IAO_0000409 denotator type http://purl.obolibrary.org/obo/IAO_0000102 data about an ontology part A denotator type indicates how a term should be interpreted from an ontological perspective. http://purl.obolibrary.org/obo/OBI_0000011 planned process http://purl.obolibrary.org/obo/BFO_0000015 process A processual entity that realizes a plan which is the concretization of a plan specification. http://purl.obolibrary.org/obo/OBI_0000181 population http://purl.obolibrary.org/obo/GENO_0000113 taxonomic group a population is a collection of individuals from the same taxonomic class living, counted or sampled at a particular site or in a particular area http://purl.obolibrary.org/obo/SO_0000105 chromosome arm http://purl.obolibrary.org/obo/SO_0000830 chromosome part A region of the chromosome between the centromere and the telomere. Human chromosomes have two arms, the p arm (short) and the q arm (long) which are separated from each other by the centromere. http://purl.obolibrary.org/obo/SO_0001505 reference genome sequence http://purl.obolibrary.org/obo/GENO_0000017 reference sequence A genome sequence that is used as a standard against which other genome sequences are compared, or into which alterations are intentionally introduced. http://biohackathon.org/resource/faldo#ExactPosition Exact position http://biohackathon.org/resource/faldo#Position Position A position that is exactly known. http://biohackathon.org/resource/faldo#Position Position http://purl.obolibrary.org/obo/GENO_0000902 genomic feature location Superclass for the general concept of a position on a sequence. The sequence is designated with the reference predicate. http://biohackathon.org/resource/faldo#Region Region http://purl.obolibrary.org/obo/SO_0000110 sequence_feature A region describes a length of sequence with a start position and end position that represents a feature on a sequence, e.g. a gene. http://purl.obolibrary.org/obo/GENO_0000009 genomic variation complement http://purl.obolibrary.org/obo/GENO_0000660 genomic feature set A genomic feature set representing all 'variant single locus complements' in a single genome, which together constitute the 'variant' component of a genomic genotype. http://purl.obolibrary.org/obo/GENO_0000014 gene allele http://purl.obolibrary.org/obo/GENO_0000512 allele A genomic feature that represents one of a set of versions of a gene (i.e. a haplotype whose extent is that of a gene) http://purl.obolibrary.org/obo/GENO_0000033 variant genome http://purl.obolibrary.org/obo/SO_0001026 genome A genome that varies at one or more loci from the sequence of some reference genome. http://purl.obolibrary.org/obo/GENO_0000036 reference allele http://purl.obolibrary.org/obo/GENO_0000512 allele An allele whose sequence matches what is consdiered to be the reference sequence at that location in the genome. http://purl.obolibrary.org/obo/GENO_0000047 danio rerio gene http://purl.obolibrary.org/obo/SO_0000704 gene A gene that originates from the genome of a danio rerio. http://purl.obolibrary.org/obo/GENO_0000054 homo sapiens gene http://purl.obolibrary.org/obo/SO_0000704 gene A gene that originates from the genome of a homo sapiens. http://purl.obolibrary.org/obo/GENO_0000057 mus musculus gene http://purl.obolibrary.org/obo/SO_0000704 gene A gene that originates from the genome of a mus musculus. http://purl.obolibrary.org/obo/GENO_0000093 integrated transgene http://purl.obolibrary.org/obo/SO_0000902 transgene A transgene that has been integrated into a chrromosome in the host genome. http://purl.obolibrary.org/obo/GENO_0000106 genomic material http://purl.obolibrary.org/obo/GENO_0000482 genetic material A nucleic acid macromolecule that is part of a cell or virion and has been inherited from an ancestor cell or virion, and/or is capable of being replicated and inherited through successive generations of progeny. http://purl.obolibrary.org/obo/GENO_0000131 in cis http://purl.obolibrary.org/obo/GENO_0000886 allelic phase A quality inhering in a collection of discontinuous sequence features in a single genome that reside on the same macromolecule (eg the same chromosomes). http://purl.obolibrary.org/obo/GENO_0000132 in trans http://purl.obolibrary.org/obo/GENO_0000886 allelic phase A quality inhering in a collection of discontinuous sequence features in a single genome that reside on different macromolecules (e.g. different chromosomes). http://purl.obolibrary.org/obo/GENO_0000134 hemizygous http://purl.obolibrary.org/obo/GENO_0000391 disomic zygosity A zygosity quality inhering in a 'single locus complement' with half the number of alleles than normal (e.g. a single allele in a diploid genome, for example, a locus on the Y chromosome in a eukaryotic male genome, or a transgene that is present only in one of the two parental chromosome sets) http://purl.obolibrary.org/obo/GENO_0000135 heterozygous http://purl.obolibrary.org/obo/GENO_0000391 disomic zygosity A zygosity quality inhering in a 'single locus complement' where the copies of the feature at this location have at least one difference in sequence (in a eukaryotic diploid genome, this means having two distinct alleles on each of the two homologous chromosomes, one inherited from each parent). http://purl.obolibrary.org/obo/GENO_0000136 homozygous http://purl.obolibrary.org/obo/GENO_0000391 disomic zygosity A zygosity quality inhering in a 'single locus complement' where all copies of the feature at this location have the same sequence (in a eukaryotic diploid genome, this means having identical alleles on each of the two homologous chromosomes, one inherited from each parent). http://purl.obolibrary.org/obo/GENO_0000138 heritabililty http://purl.obolibrary.org/obo/BFO_0000016 disposition The disposition of an entity to be transmitted to subsequent generations following a genetic replication or organismal reproduction event. http://purl.obolibrary.org/obo/GENO_0000143 co-dominant autosomal inheritance http://purl.obolibrary.org/obo/GENO_0000147 autosomal dominant inheritance An autosomal dominant inheritance pattern wherein a heterozygous individual simultaneously expresses the distinct traits associated with each allele in the heterozygous locus. http://purl.obolibrary.org/obo/GENO_0000146 X-linked dominant inheritance http://purl.obolibrary.org/obo/GENO_0000936 X-linked inheritance An X-linked inheritance pattern wherein the trait manifests in heterozygotes. http://purl.obolibrary.org/obo/GENO_0000148 autosomal recessive inheritance http://purl.obolibrary.org/obo/GENO_0000934 autosomal inheritance An inheritance pattern wherein a trait caused by alleles of an autosomal gene manifests in homozygous but not heterozygote individuals. http://purl.obolibrary.org/obo/GENO_0000149 X-linked recessive inheritance http://purl.obolibrary.org/obo/GENO_0000936 X-linked inheritance An X-linked inheritance pattern wherein a trait caused by alleles of a gene on the X-chromosome manifests in homozygous but not heterozygote individuals. http://purl.obolibrary.org/obo/GENO_0000152 reference http://purl.obolibrary.org/obo/GENO_0000773 variation attribute An attribute inhering in a feature that is designated to serve as a standard against which 'variant' versions of the same location are compared. http://purl.obolibrary.org/obo/GENO_0000391 disomic zygosity http://purl.obolibrary.org/obo/GENO_0000133 zygosity A zygosity quality inhering in a 'single locus complement' in a genome with a normal ploidy of two (i.e. two copies of autosomal chromosomes). Disomic zygosity terms describe the degree of similarity of the two sequence features that reside at a particular location across homozygous chromosomes (or the state of being the only feature at a given locus in the case of hemizygosity). http://purl.obolibrary.org/obo/GENO_0000392 aneusomic zygosity http://purl.obolibrary.org/obo/GENO_0000133 zygosity A zygosity quality inhering in a 'single locus complement' in a genome with an abnormal ploidy at the location (i.e. an autosomal locus with one or three copies in a diploid genome). http://purl.obolibrary.org/obo/GENO_0000460 transgene part http://purl.obolibrary.org/obo/GENO_0000666 gene part A structurally or functionally defined component of a transgene (e.g. a promoter, a region coding for a fluorescent protein tag, etc) http://purl.obolibrary.org/obo/GENO_0000476 variant http://purl.obolibrary.org/obo/GENO_0000773 variation attribute An attribute inhering in a sequence feature that varies from some designated reference in virtue of alterations in its sequence or expression level http://purl.obolibrary.org/obo/GENO_0000477 polymorphic http://purl.obolibrary.org/obo/GENO_0000773 variation attribute An attribute inhereing in a sequence feature for which there is more than one version fixed in a population at some significant percentage (typically 1% or greater), where the locus is not considered to be either reference or a variant. http://purl.obolibrary.org/obo/GENO_0000480 mutant http://purl.obolibrary.org/obo/GENO_0000773 variation attribute An attribute inhering in a feature bearing a sequence alteration that is present at very low levels in a given population (typically less than 1%), or that has been experimentally generated to alter the feature with respect to some reference sequence. http://purl.obolibrary.org/obo/GENO_0000481 genomic feature http://purl.obolibrary.org/obo/GENO_0000897 genomic entity A sequence feature (continuous extent of biological sequence) that is of genomic origin (i.e. carries sequence from the genome of a cell or organism) http://purl.obolibrary.org/obo/GENO_0000482 genetic material http://purl.obolibrary.org/obo/CHEBI_33696 nucleic acid A nucleic acid molecule that contains one or more sequences serving as a template for gene expression in a biological system (ie a cell or virion). http://purl.obolibrary.org/obo/GENO_0000492 mutation http://purl.obolibrary.org/obo/SO_0001059 sequence_alteration A sequence alteration that is very rare allele in a population (typically <1%), or an experimentally-induced variation that derives from a wild-type feature in a given strain. http://purl.obolibrary.org/obo/GENO_0000497 polymorphic allele http://purl.obolibrary.org/obo/GENO_0000512 allele An allele that is fixed in a population at some stable level, typically > 1%. Polymorphic alleles reside at loci where more than one version exists at some signifcant frequency in a population. http://purl.obolibrary.org/obo/GENO_0000504 reagent targeted gene http://purl.obolibrary.org/obo/GENO_0000529 expression-variant gene A gene altered in its expression level in the context of some experiment as a result of being targeted by gene-knockdown reagent(s) such as a morpholino or RNAi. http://purl.obolibrary.org/obo/GENO_0000511 wild-type http://purl.obolibrary.org/obo/GENO_0000773 variation attribute An allele attribute describing a highly common variant (typically >99% in a population), that typically exhibits canonical function, and against which rare and/or non-functional mutant alleles are compared. http://purl.obolibrary.org/obo/GENO_0000513 aneusomic http://purl.obolibrary.org/obo/GENO_0000773 variation attribute a sequence attribute of a chromosome or chromosomal region that has been abnormally duplicated or lost, as the result of a non-disjunction event or unbalanced translocation. http://purl.obolibrary.org/obo/GENO_0000515 variant gene allele http://purl.obolibrary.org/obo/GENO_0000014 gene allele An allele of a gene that contains some sequence alteration. http://purl.obolibrary.org/obo/GENO_0000525 effective genotype http://purl.obolibrary.org/obo/GENO_0000536 genotype A genotype that describes the total intrinsic and extrinsic variation across a genome at the time of a phenotypic assessment (where 'intrinsic' refers to variation in genomic sequence, as mediated by sequence alterations, and 'extrinsic' refers to variation in gene expression, as mediated through transient gene-specific interventions such as gene knockdown reagents or overexpression constructs). http://purl.obolibrary.org/obo/GENO_0000527 reagent-targeted gene complement http://purl.obolibrary.org/obo/GENO_0000715 qualified genomic feature set A set comprised of *all* reagent-targeted genes in a single genome in the context of a given experiment (e.g. the zebrafish shha and shhb genes in a zebrafish exposed to morpholinos targeting both of these genes). http://purl.obolibrary.org/obo/GENO_0000536 genotype http://purl.obolibrary.org/obo/IAO_0000030 information content entity A specification of the genetic state of an organism, whether complete (defined over the whole genome) or incomplete (defined over a subset of the genome). Genotypes typically describe this genetic state as a diff between some variant component and a canonical reference. http://purl.obolibrary.org/obo/GENO_0000602 homoplasmic http://purl.obolibrary.org/obo/GENO_0000918 organellar plasmy an allelic state where a single allele exists at a particular location in the organellar genome (mitochondrial or plastid) of a cell/organism. http://purl.obolibrary.org/obo/GENO_0000603 heteroplasmic http://purl.obolibrary.org/obo/GENO_0000918 organellar plasmy an allelic state where more than one type of allele exists at a particular location in the organellar genome (mitochondrial or plastid) of a cell/organism. http://purl.obolibrary.org/obo/GENO_0000614 chromosomal region http://purl.obolibrary.org/obo/SO_0000830 chromosome part An extended part of a chromosome representing a term of convenience in order to hierarchically organize morphologically defined chromosome features: chromosome > arm > region > band > sub-band. http://purl.obolibrary.org/obo/GENO_0000637 regulatory transgene region http://purl.obolibrary.org/obo/SO_0005836 regulatory_region A transgene part whose sequence regulates the synthesis of a functional product, but which is not itself transcribed. http://purl.obolibrary.org/obo/GENO_0000642 selectable marker transgene http://purl.obolibrary.org/obo/SO_0000902 transgene A transgene whose product is used as a selectable marker. http://purl.obolibrary.org/obo/GENO_0000644 karyotype http://purl.obolibrary.org/obo/GENO_0000899 genomic genotype A genotype that describes what is known about variation in a genome at a gross structural level, in terms of the number and appearance of chromosomes in the nucleus of a eukaryotic cell. http://purl.obolibrary.org/obo/GENO_0000646 male intrinsic genotype http://purl.obolibrary.org/obo/GENO_0000645 genomic genotype (sex-qualified) A genomic genotype here the genomic background specifies a male sex chromosome complement. http://purl.obolibrary.org/obo/GENO_0000647 female intrinsic genotype http://purl.obolibrary.org/obo/GENO_0000645 genomic genotype (sex-qualified) A genomic genotype here the genomic background specifies a female sex chromosome complement. http://purl.obolibrary.org/obo/GENO_0000659 sequence feature set http://purl.obolibrary.org/obo/GENO_0000701 sequence feature or set A set of sequence features. http://purl.obolibrary.org/obo/GENO_0000667 reporter transgene http://purl.obolibrary.org/obo/SO_0000902 transgene A transgene that codes for a product used as a reporter of gene expression or activity. http://purl.obolibrary.org/obo/GENO_0000684 novel replicon http://purl.obolibrary.org/obo/SO_0001059 sequence_alteration A genomic feature that represents an entirely new replicon in the genome, e.g. an extrachromosomal replicon or an extra copy of a chromosome. http://purl.obolibrary.org/obo/GENO_0000685 novel http://purl.obolibrary.org/obo/GENO_0000773 variation attribute An attribute of a genomic feature that represents a feature not previously found in a given genome, e.g. an extrachromosomal replicon or aneusomic third copy of a chromosome. http://purl.obolibrary.org/obo/GENO_0000688 terminus http://purl.obolibrary.org/obo/SO_0000110 sequence_feature A sequence feature representing the end of a sequence that is bounded only on one side (e.g. at the end of an chromosome or oligonucleotide). http://purl.obolibrary.org/obo/GENO_0000713 qualified sequence feature or collection http://purl.obolibrary.org/obo/BFO_0000031 generically dependent continuant A sequence feature (or collection of features) whose identity is dependent on the context or state of its material bearer (in addition to its sequence an position). This context/state describes factors external to its inherent sequence and position that can influences its expression, such as being targeted by gene-knockdown reagents, or an epigenetic modification. http://purl.obolibrary.org/obo/GENO_0000714 qualified genomic feature http://purl.obolibrary.org/obo/GENO_0000897 genomic entity A qualified sequence feature that carries sequence derived from the genome of a cell or organism. http://purl.obolibrary.org/obo/GENO_0000715 qualified genomic feature set http://purl.obolibrary.org/obo/GENO_0000897 genomic entity A set of qualified sequence features that carry genomic sequence. http://purl.obolibrary.org/obo/GENO_0000736 location-qualified sequence feature http://purl.obolibrary.org/obo/GENO_0000714 qualified genomic feature A sequence feature whose identity is additionally dependent on the cellular or anatomical location of the genetic material bearing the feature. http://purl.obolibrary.org/obo/GENO_0000737 expression-qualified sequence feature http://purl.obolibrary.org/obo/GENO_0000714 qualified genomic feature A sequence feature whose identity is additionally dependent on factors specifically influencing its level of expression in the context of a biological system (e.g. being targeted by gene-knockdown reagents, or driven from exogneous expression system like recombinant construct) http://purl.obolibrary.org/obo/GENO_0000777 variant genomic genotype http://purl.obolibrary.org/obo/GENO_0000899 genomic genotype An intrinsic genotype that specifies variation from a defined reference genome. http://purl.obolibrary.org/obo/GENO_0000788 sequence feature attribute http://purl.obolibrary.org/obo/BFO_0000020 specifically dependent continuant An attribute, quality, or state of a sequence feature or collection. http://purl.obolibrary.org/obo/GENO_0000815 sequence feature location http://purl.obolibrary.org/obo/BFO_0000031 generically dependent continuant The location of a sequence feature as defined by its start and end position on some reference coordinate system. http://purl.obolibrary.org/obo/GENO_0000818 modification-qualified sequence feature http://purl.obolibrary.org/obo/GENO_0000714 qualified genomic feature A sequence feature whose identity is additionally dependent on a chemical modification made to the genetic material bearing the feature (e.g. binding of transcriptional regulators, or epigenetic modifications including direct DNA methylation, or modification of histones associated with a feature) http://purl.obolibrary.org/obo/GENO_0000850 P-element construct http://purl.obolibrary.org/obo/GENO_0000856 engineered genetic construct A construct that contains a mobile P-element, holding sequences to be delivered to a target cell or genome. http://purl.obolibrary.org/obo/SO_0000034 morpholino_oligo http://purl.obolibrary.org/obo/GENO_0000533 gene knockdown reagent Morpholino oligos are synthesized from four different Morpholino subunits, each of which contains one of the four genetic bases (A, C, G, T) linked to a 6-membered morpholine ring. Eighteen to 25 subunits of these four subunit types are joined in a specific order by non-ionic phosphorodiamidate intersubunit linkages to give a Morpholino. http://purl.obolibrary.org/obo/SO_0000289 microsatellite http://purl.obolibrary.org/obo/GENO_0000481 genomic feature A repeat_region containing repeat_units of 2 to 10 bp repeated in tandem. http://purl.obolibrary.org/obo/SO_0000341 chromosome band http://purl.obolibrary.org/obo/SO_0000830 chromosome part A cytologically distinguishable feature of a chromosome, often made visible by staining, and usually alternating light and dark. http://purl.obolibrary.org/obo/SO_0000783 engineered http://purl.obolibrary.org/obo/GENO_0000788 sequence feature attribute An attribute to describe a region that was modified in vitro. http://purl.obolibrary.org/obo/SO_0001477 gene_trap_construct http://purl.obolibrary.org/obo/GENO_0000856 engineered genetic construct A construct which is designed to integrate into a genome and produce a fusion transcript between exons of the gene into which it inserts and a reporter element in the construct. Gene traps contain a splice acceptor, do not contain promoter elements for the reporter, and are mutagenic. Gene traps may be bicistronic with the second cassette containing a promoter driving an a selectable marker. http://purl.obolibrary.org/obo/SO_0001478 promoter_trap_construct http://purl.obolibrary.org/obo/GENO_0000856 engineered genetic construct A construct which is designed to integrate into a genome and express a reporter when inserted in close proximity to a promoter element. Promoter traps typically do not contain promoter elements and are mutagenic. http://purl.obolibrary.org/obo/SO_0001479 enhancer_trap_construct http://purl.obolibrary.org/obo/GENO_0000856 engineered genetic construct A construct which is designed to integrate into a genome and express a reporter when the expression from a basic minimal promoter is enhanced by genomic enhancer elements. Enhancer traps contain promoter elements and are not usually mutagenic. http://purl.obolibrary.org/obo/GENO_0000885 diplotype http://purl.obolibrary.org/obo/GENO_0000823 allelic genotype An allelic genotype specifying the set of two alleles present at a particular location in a diploid genome (i.e., a diploid 'single locus complement') Alt: A sequence feature complement comprised of two haplotypes at a particular location on paired homologous chromosomes in a diploid genome. http://purl.obolibrary.org/obo/GENO_0000892 heteroplasmic mitochondrial inheritance http://purl.obolibrary.org/obo/GENO_0000949 mitochondrial inheritance A mitochondrial inheritance pattern whereby manifestation of a trait is observed when some inherited mitochondria contian the causative allele and some do not. http://purl.obolibrary.org/obo/GENO_0000893 homoplasmic mitochondrial inheritance http://purl.obolibrary.org/obo/GENO_0000949 mitochondrial inheritance A mitochondrial inheritance pattern whereby manifestation of a trait occurs when only mitochondria containing the causative allele are inherited. http://purl.obolibrary.org/obo/PCO_0000000 collection of organisms http://purl.obolibrary.org/obo/GENO_0000904 organismal entity A material entity that consists of two or more organisms, viruses, or viroids. http://purl.obolibrary.org/obo/PCO_0000020 family http://purl.obolibrary.org/obo/PCO_0000000 collection of organisms A domestic group, or a number of domestic groups linked through descent (demonstrated or stipulated) from a common ancestor, marriage, or adoption. http://purl.obolibrary.org/obo/SO_0000167 promoter http://purl.obolibrary.org/obo/SO_0005836 regulatory_region A regulatory_region composed of the TSS(s) and binding sites for TF_complexes of the basal transcription machinery. http://purl.obolibrary.org/obo/SO_0000340 chromosome http://purl.obolibrary.org/obo/GENO_0000481 genomic feature Structural unit composed of a nucleic acid molecule which controls its own replication through the interaction of specific proteins at one or more origins of replication. http://purl.obolibrary.org/obo/GENO_0000943 Z-linked dominant inheritance http://purl.obolibrary.org/obo/GENO_0000942 Z-linked inheritance A Z-linked inheritance pattern wherein the trait manifests in heterozygotes. http://purl.obolibrary.org/obo/GENO_0000932 polygenic inheritance http://purl.obolibrary.org/obo/GENO_0000929 multifactorial inheritance A multifactorial inheritance pattern that is determined by the simultaneous action of alleles a large number of genes. http://purl.obolibrary.org/obo/GENO_0000918 organellar plasmy http://purl.obolibrary.org/obo/GENO_0000875 allelic state An allelic state that describes the number of different alleles of a gene from an organellar genome (i.e. mitochondrial, plastid) that may exist in a cell. http://purl.obolibrary.org/obo/GENO_0000930 digenic inheritance http://purl.obolibrary.org/obo/GENO_0000929 multifactorial inheritance A multifactorial inheritance pattern that is determined by the simultaneous action of alleles in two genes. http://purl.obolibrary.org/obo/GENO_0000947 Z-linked reccessive inheritance http://purl.obolibrary.org/obo/GENO_0000942 Z-linked inheritance A Z-linked inheritance pattern wherein a trait caused by alleles of a gene on the Z-chromosome manifests in homozygous but not heterozygote individuals. http://purl.obolibrary.org/obo/GENO_0000946 co-dominant Z-linked inheritance http://purl.obolibrary.org/obo/GENO_0000943 Z-linked dominant inheritance An Z-linked dominant inheritance pattern wherein a heterozygous individual simultaneously expresses the distinct traits associated with each allele in the heterozygous locus. http://purl.obolibrary.org/obo/GENO_0000949 mitochondrial inheritance http://purl.obolibrary.org/obo/GENO_0000141 inheritance pattern An inheritance pattern observed for traits related to a gene encoded on the mitochondrial genome. http://purl.obolibrary.org/obo/GENO_0000944 complete Z-linked dominant inheritance http://purl.obolibrary.org/obo/GENO_0000943 Z-linked dominant inheritance A Z-linked dominant inheritance pattern wherein the trait associated with one allele completely masks the trait associated with a different allele found at that locus. http://purl.obolibrary.org/obo/GENO_0000974 inherited allele origin http://purl.obolibrary.org/obo/GENO_0000877 allele origin Describes an allele that is inherited from a parent. http://purl.obolibrary.org/obo/GENO_0000975 uniparental allele origin http://purl.obolibrary.org/obo/GENO_0000974 inherited allele origin Describes an allele that is part of an allelic complement where both alleles are inherited from the same parent. http://purl.obolibrary.org/obo/GENO_0000976 biparental allele origin http://purl.obolibrary.org/obo/GENO_0000974 inherited allele origin Describes an allele that is part of an allelic complement where one allele is maternally inherited and other paternally inherited. http://purl.obolibrary.org/obo/GO_0032502 developmental process http://purl.obolibrary.org/obo/GENO_0000351 biological process A biological process whose specific outcome is the progression of an integrated living unit: an anatomical structure (which may be a subcellular structure, cell, tissue, or organ), or organism over time from an initial condition to a later condition. [database_cross_reference: GOC:isa_complete] http://purl.obolibrary.org/obo/SO_0000902 transgene http://purl.obolibrary.org/obo/SO_0000704 gene A gene that has been transferred naturally or by any of a number of genetic engineering techniques into a cell or organism where it is foreign (i.e. does not belong to the host genome). http://purl.obolibrary.org/obo/SO_0001500 heritable_phenotypic_marker http://purl.obolibrary.org/obo/GENO_0000481 genomic feature A biological_region characterized as a single heritable trait in a phenotype screen. The heritable phenotype may be mapped to a chromosome but generally has not been characterized to a specific gene locus. http://purl.obolibrary.org/obo/GENO_0000871 haplotype http://purl.obolibrary.org/obo/GENO_0000660 genomic feature set A set of discrete, genetically-linked sequence alterations that reside on the same chromosomal strand and are typically co-inherited within a haplotype block. http://purl.obolibrary.org/obo/SO_0000110 sequence_feature http://purl.obolibrary.org/obo/GENO_0000701 sequence feature or set Any extent of continuous biological sequence. http://purl.obolibrary.org/obo/SO_0000704 gene http://purl.obolibrary.org/obo/GENO_0000481 genomic feature A region (or regions) that includes all of the sequence elements necessary to encode a functional transcript. A gene may include regulatory regions, transcribed regions and/or other functional sequence regions. http://purl.obolibrary.org/obo/GENO_0000919 qualified sequence feature http://purl.obolibrary.org/obo/GENO_0000713 qualified sequence feature or collection A sequence feature whose identity is additionally dependent on the context or state of the material sequence molecule in which the feature is concretized. This context/state describes factors external to the feature's intrinsic sequence and position that can influences its expression, such as being targeted by gene-knockdown reagents, or an epigenetic modification. http://purl.obolibrary.org/obo/GENO_0000920 qualified sequence feature set http://purl.obolibrary.org/obo/GENO_0000713 qualified sequence feature or collection A set of qualified seqeunce features. http://purl.obolibrary.org/obo/GENO_0000922 biological sequence set http://purl.obolibrary.org/obo/GENO_0000921 biological sequence or set A set of biological sequences. http://purl.obolibrary.org/obo/GENO_0000926 allelic cellular distribution http://purl.obolibrary.org/obo/GENO_0000788 sequence feature attribute A quality inhering in an allele reflecting whether it is found in all cells of an organism's body, or just some clonal subset (e.g. in mosaicism). http://purl.obolibrary.org/obo/GENO_0000927 constitutional http://purl.obolibrary.org/obo/GENO_0000926 allelic cellular distribution A cellular distribution in which an allele is found in all cells of an organism's body, typically in virtue of its germline origin. http://purl.obolibrary.org/obo/GENO_0000928 clonal http://purl.obolibrary.org/obo/GENO_0000926 allelic cellular distribution A cellular distribuution in which an allele is found only in some clonal subset of cells in an organism, typically in virtue of its somatic origin. http://purl.obolibrary.org/obo/GENO_0000936 X-linked inheritance http://purl.obolibrary.org/obo/GENO_0000935 allosomal inheritance An inheritance pattern wherein the trait is determined by alleles of a single causal gene on an X-chromosome. http://purl.obolibrary.org/obo/GENO_0000942 Z-linked inheritance http://purl.obolibrary.org/obo/GENO_0000935 allosomal inheritance An inheritance pattern wherein the trait is determined by alleles of a single causal gene on a Z-chromosome. http://purl.obolibrary.org/obo/GENO_0000931 oligogenic inheritance http://purl.obolibrary.org/obo/GENO_0000929 multifactorial inheritance A multifactorial inheritance pattern that is determined by the simultaneous action of alleles in few genes. http://purl.obolibrary.org/obo/GENO_0000948 W-linked inheritance http://purl.obolibrary.org/obo/GENO_0000935 allosomal inheritance An inheritance pattern wherein the trait is determined by alleles of a single causal gene on a W-chromosome. http://purl.obolibrary.org/obo/GENO_0000952 sex-limited autosomal dominant inheritance http://purl.obolibrary.org/obo/GENO_0000147 autosomal dominant inheritance An autosomal dominant inheritance pattern wherein the trait manifests in heterozygotes in a sex-specific manner (i.e. only in males or only in females). http://purl.obolibrary.org/obo/SO_1000002 substitution http://purl.obolibrary.org/obo/SO_0001059 sequence_alteration Any change in genomic DNA caused by a single event. http://purl.obolibrary.org/obo/SO_1000009 transition http://purl.obolibrary.org/obo/SO_0001483 SNV Change of a pyrimidine nucleotide, C or T, into an other pyrimidine nucleotide, or change of a purine nucleotide, A or G, into an other purine nucleotide. http://purl.obolibrary.org/obo/SO_1000017 transversion http://purl.obolibrary.org/obo/SO_0001483 SNV Change of a pyrimidine nucleotide, C or T, into a purine nucleotide, A or G, or vice versa. http://purl.obolibrary.org/obo/SO_1000032 indel http://purl.obolibrary.org/obo/SO_0001059 sequence_alteration A sequence alteration which included an insertion and a deletion, affecting 2 or more bases. http://purl.obolibrary.org/obo/GENO_0000875 allelic state http://purl.obolibrary.org/obo/GENO_0000788 sequence feature attribute A quality inhering in an 'allelic complement' (aka a 'single locus complement') that describes the allelic variability found at a particular locus in the genome of a single cell/organism http://purl.obolibrary.org/obo/GENO_0000880 de novo allele origin http://purl.obolibrary.org/obo/GENO_0000877 allele origin Describes an allele that originated through a mutation event in a germ cell of one of the parents, or in the fertilized egg itself during early embryogenesis. De novo alleles are* heritable* but *not inherited*. http://purl.obolibrary.org/obo/GENO_0000881 unknown allele origin http://purl.obolibrary.org/obo/GENO_0000877 allele origin Describes an allele whose origin is not known. http://purl.obolibrary.org/obo/GENO_0000886 allelic phase http://purl.obolibrary.org/obo/GENO_0000788 sequence feature attribute A quality inhering in a collection of discontinuous sequence features in a single genome in virtue of their relative position on the same or separate chromosomes. http://purl.obolibrary.org/obo/GENO_0000939 co-dominant X-linked inheritance http://purl.obolibrary.org/obo/GENO_0000146 X-linked dominant inheritance An X-linked dominant inheritance pattern wherein a heterozygous individual simultaneously expresses the distinct traits associated with each allele in the heterozygous locus. http://purl.obolibrary.org/obo/GENO_0000934 autosomal inheritance http://purl.obolibrary.org/obo/GENO_0000933 monogenic inheritance An inheritance pattern wherein the trait is determined by alleles of a single causal gene on a non-sex chromosome. http://purl.obolibrary.org/obo/GENO_0000953 sex-limited autosomal recessive inheritance http://purl.obolibrary.org/obo/GENO_0000148 autosomal recessive inheritance An autosomal recessive inheritance pattern wherein the trait manifests only in homozygotes, and in a sex-specific manner (i.e. only in males or only in females). http://purl.obolibrary.org/obo/GENO_0000937 complete X-linked dominant inheritance http://purl.obolibrary.org/obo/GENO_0000146 X-linked dominant inheritance An X-linked dominant inheritance pattern wherein the trait associated with one allele completely masks the trait associated with a different allele found at that locus. http://purl.obolibrary.org/obo/GENO_0000969 chromosomal inheritance http://purl.obolibrary.org/obo/GENO_0000141 inheritance pattern An inheritance pattern wherein the trait is determined by inheritance of extra, missing, or re-arranged chromosomes possibly together with environmental factors. http://purl.obolibrary.org/obo/GENO_0000970 chromosomal deletion inheritance http://purl.obolibrary.org/obo/GENO_0000969 chromosomal inheritance An inheritance pattern wherein the trait is determined by inheritance of missing sections of one or more chromosomes, encompassing either 0 or multiple genes, possibly together with environmental factors. http://purl.obolibrary.org/obo/GENO_0000971 chromosomal duplication inheritance http://purl.obolibrary.org/obo/GENO_0000969 chromosomal inheritance An inheritance pattern wherein the trait is determined by inheritance of duplicated sections of one or more chromosomes, encompassing either 0 or multiple genes, possibly together with environmental factors. http://purl.obolibrary.org/obo/GENO_0000972 chromosomal rearrangement inheritance http://purl.obolibrary.org/obo/GENO_0000969 chromosomal inheritance An inheritance pattern wherein the trait is determined by inheritance of translocation or inversion of sections of one or more chromosomes, possibly together with environmental factors. http://purl.obolibrary.org/obo/GENO_0000978 nullizygous http://purl.obolibrary.org/obo/GENO_0000391 disomic zygosity A disomic zygosity quality inhering in a 'single locus complement' that is comprised of two non-functional copies of a gene. Loss of function may result from the gene being entirely missing via a deletion, or mutated in a way that eliminates its function. http://purl.obolibrary.org/obo/GENO_0000960 genomic sequence http://purl.obolibrary.org/obo/GENO_0000702 biological sequence A biological sequence that is of genomic origin (i.e. carries sequence from the genome of a cell or organism). http://purl.obolibrary.org/obo/GENO_0000961 copy number complement http://purl.obolibrary.org/obo/GENO_0000872 genomic sequence set A set representing the complement of all copies of a particular biological sequence (typically at the scale of complete genes or larger) present in a particular genome. http://purl.obolibrary.org/obo/GENO_0000962 variant copy number complement http://purl.obolibrary.org/obo/GENO_0000961 copy number complement A 'copy number complement' that has an abnormal number of members, as the result of deletion or duplication event(s). http://purl.obolibrary.org/obo/IAO_8000001 base ontology module http://purl.obolibrary.org/obo/IAO_8000000 ontology module An ontology module that comprises only of asserted axioms local to the ontology, excludes import directives, and excludes axioms or declarations from external ontologies. http://purl.obolibrary.org/obo/IAO_8000003 main release ontology module http://purl.obolibrary.org/obo/IAO_8000000 ontology module An ontology module that is intended to be the primary release product and the one consumed by the majority of tools. http://purl.obolibrary.org/obo/IAO_8000004 bridge ontology module http://purl.obolibrary.org/obo/IAO_8000000 ontology module An ontology module that consists entirely of axioms that connect or bridge two distinct ontology modules. For example, the Uberon-to-ZFA bridge module. http://purl.obolibrary.org/obo/IAO_8000007 curation subset ontology module http://purl.obolibrary.org/obo/IAO_8000006 subset ontology module A subset ontology that is intended as a whitelist for curators using the ontology. Such a subset will exclude classes that curators should not use for curation. http://purl.obolibrary.org/obo/IAO_8000008 analysis subset ontology module http://purl.obolibrary.org/obo/IAO_8000006 subset ontology module An ontology module that is intended for usage in analysis or discovery applications. http://purl.obolibrary.org/obo/IAO_8000013 reasoned ontology module http://purl.obolibrary.org/obo/IAO_8000000 ontology module An ontology module that contains axioms generated by a reasoner. The generated axioms are typically direct SubClassOf axioms, but other possibilities are available. http://purl.obolibrary.org/obo/IAO_8000014 generated ontology module http://purl.obolibrary.org/obo/IAO_8000000 ontology module An ontology module that is automatically generated, for example via a SPARQL query or via template and a CSV. http://purl.obolibrary.org/obo/IAO_8000015 template generated ontology module http://purl.obolibrary.org/obo/IAO_8000014 generated ontology module An ontology module that is automatically generated from a template specification and fillers for slots in that template. http://purl.obolibrary.org/obo/IAO_8000018 obo basic subset ontology module http://purl.obolibrary.org/obo/IAO_8000017 ontology module subsetted by expressivity A subset ontology that is designed for basic applications to continue to make certain simplifying assumptions; many of these simplifying assumptions were based on the initial version of the Gene Ontology, and have become enshrined in many popular and useful tools such as term enrichment tools. Examples of such assumptions include: traversing the ontology graph ignoring relationship types using a naive algorithm will not lead to cycles (i.e. the ontology is a DAG); every referenced term is declared in the ontology (i.e. there are no dangling clauses). An ontology is OBO Basic if and only if it has the following characteristics: DAG Unidirectional No Dangling Clauses Fully Asserted Fully Labeled No equivalence axioms Singly labeled edges No qualifier lists No disjointness axioms No owl-axioms header No imports http://purl.obolibrary.org/obo/GENO_0000897 genomic entity http://purl.obolibrary.org/obo/BFO_0000031 generically dependent continuant An generically dependent continuant that carries biological sequence that is part of or derived from a genome. http://purl.obolibrary.org/obo/GENO_0000898 haplotype block http://purl.obolibrary.org/obo/GENO_0000481 genomic feature A sequence feature representing a region of the genome over which there is little evidence for historical recombination, such that sequence alterations it contains are typically co-inherited across generations. http://purl.obolibrary.org/obo/GENO_0000954 allele set http://purl.obolibrary.org/obo/GENO_0000660 genomic feature set A set of discrete alleles within a particular genome. http://purl.obolibrary.org/obo/GENO_0000965 sequence interval http://purl.obolibrary.org/obo/IAO_0000030 information content entity A pair of integers representing start and end position of a location on a sequence coordinate system. http://purl.obolibrary.org/obo/GENO_0000137 unspecified zygosity http://purl.obolibrary.org/obo/GENO_0000133 zygosity unknown zygosity http://purl.obolibrary.org/obo/GENO_0000495 expression construct http://purl.obolibrary.org/obo/GENO_0000856 engineered genetic construct expression construct feature http://purl.obolibrary.org/obo/GENO_0000502 wild-type gene http://purl.obolibrary.org/obo/SO_0000704 gene wild-type gene allele http://purl.obolibrary.org/obo/GENO_0000533 gene knockdown reagent http://purl.obolibrary.org/obo/SO_0000804 engineered_region sequence targeting reagent http://purl.obolibrary.org/obo/GENO_0000618 chromosomal band intensity http://purl.obolibrary.org/obo/GENO_0000788 sequence feature attribute chromosomal band brightness http://purl.obolibrary.org/obo/GENO_0000779 biological sequence unit http://purl.obolibrary.org/obo/GENO_0000702 biological sequence monomeric residue http://purl.obolibrary.org/obo/GENO_0000780 DNA residue http://purl.obolibrary.org/obo/GENO_0000779 biological sequence unit deoxyribonucleic acid residue http://purl.obolibrary.org/obo/GENO_0000781 RNA residue http://purl.obolibrary.org/obo/GENO_0000779 biological sequence unit ribonucleic acid residue http://purl.obolibrary.org/obo/SO_0000804 engineered_region http://purl.obolibrary.org/obo/SO_0000110 sequence_feature construct http://purl.obolibrary.org/obo/SO_0005836 regulatory_region http://purl.obolibrary.org/obo/GENO_0000666 gene part regulatory gene region http://purl.obolibrary.org/obo/SO_0000207 simple_sequence_length_variation http://purl.obolibrary.org/obo/SO_0000248 sequence_length_variation simple sequence length variation http://purl.obolibrary.org/obo/SO_0000248 sequence_length_variation http://purl.obolibrary.org/obo/SO_1000002 substitution sequence length variation http://purl.obolibrary.org/obo/SO_1000013 T_to_C_transition http://purl.obolibrary.org/obo/SO_1000010 pyrimidine_transition T to C transition http://purl.obolibrary.org/obo/SO_1000020 C_to_G_transversion http://purl.obolibrary.org/obo/SO_1000018 pyrimidine_to_purine_transversion C to G transversion http://purl.obolibrary.org/obo/IAO_8000000 ontology module http://purl.obolibrary.org/obo/IAO_0000102 data about an ontology part ontology file http://purl.obolibrary.org/obo/IAO_8000017 ontology module subsetted by expressivity http://purl.obolibrary.org/obo/IAO_8000006 subset ontology module http://purl.obolibrary.org/obo/CHEBI_33696 nucleic acid http://purl.obolibrary.org/obo/CHEBI_23367 molecular entity http://purl.obolibrary.org/obo/PATO_0000383 female http://purl.obolibrary.org/obo/PATO_0001894 phenotypic sex http://purl.obolibrary.org/obo/PATO_0000384 male http://purl.obolibrary.org/obo/PATO_0001894 phenotypic sex http://purl.obolibrary.org/obo/OBI_0100026 organism http://purl.obolibrary.org/obo/GENO_0000904 organismal entity http://purl.obolibrary.org/obo/UBERON_0001062 anatomical entity http://purl.obolibrary.org/obo/GENO_0000904 organismal entity http://purl.obolibrary.org/obo/BFO_0000002 continuant http://purl.obolibrary.org/obo/BFO_0000001 entity http://purl.obolibrary.org/obo/BFO_0000003 occurrent http://purl.obolibrary.org/obo/BFO_0000001 entity http://purl.obolibrary.org/obo/BFO_0000040 material entity http://purl.obolibrary.org/obo/BFO_0000004 independent continuant http://purl.obolibrary.org/obo/GENO_0000351 biological process http://purl.obolibrary.org/obo/BFO_0000015 process http://purl.obolibrary.org/obo/BFO_0000016 disposition http://purl.obolibrary.org/obo/BFO_0000017 realizable entity http://purl.obolibrary.org/obo/BFO_0000023 role http://purl.obolibrary.org/obo/BFO_0000017 realizable entity http://purl.obolibrary.org/obo/PATO_0001894 phenotypic sex http://purl.obolibrary.org/obo/BFO_0000019 quality http://purl.obolibrary.org/obo/BFO_0000017 realizable entity http://purl.obolibrary.org/obo/BFO_0000020 specifically dependent continuant http://purl.obolibrary.org/obo/BFO_0000019 quality http://purl.obolibrary.org/obo/BFO_0000020 specifically dependent continuant http://purl.obolibrary.org/obo/UPHENO_0001001 Phenotype http://purl.obolibrary.org/obo/BFO_0000020 specifically dependent continuant http://purl.obolibrary.org/obo/OBI_0000086 reagent role http://purl.obolibrary.org/obo/BFO_0000023 role http://purl.obolibrary.org/obo/CHEBI_23367 molecular entity http://purl.obolibrary.org/obo/BFO_0000040 material entity http://purl.obolibrary.org/obo/ENVO_01000254 environmental system http://purl.obolibrary.org/obo/BFO_0000040 material entity http://purl.obolibrary.org/obo/IAO_0000027 data item http://purl.obolibrary.org/obo/IAO_0000030 information content entity http://purl.org/oban/association association http://purl.obolibrary.org/obo/IAO_0000030 information content entity http://purl.obolibrary.org/obo/NCBITaxon_10239 Viruses http://purl.obolibrary.org/obo/OBI_0100026 organism http://purl.obolibrary.org/obo/NCBITaxon_9606 Homo sapiens http://purl.obolibrary.org/obo/OBI_0100026 organism http://purl.obolibrary.org/obo/NCBITaxon_10090 Mus musculus http://purl.obolibrary.org/obo/OBI_0100026 organism http://purl.obolibrary.org/obo/NCBITaxon_7955 Danio rerio http://purl.obolibrary.org/obo/OBI_0100026 organism http://purl.obolibrary.org/obo/NCBITaxon_8090 Oryzias latipes http://purl.obolibrary.org/obo/OBI_0100026 organism http://purl.obolibrary.org/obo/GENO_0000160 unspecified life cycle stage http://purl.obolibrary.org/obo/UBERON_0000105 life cycle stage http://purl.obolibrary.org/obo/CL_0000000 cell http://purl.obolibrary.org/obo/UBERON_0001062 anatomical entity http://biohackathon.org/resource/faldo#StrandedPosition Stranded position http://biohackathon.org/resource/faldo#Position Position http://biohackathon.org/resource/faldo#BothStrandsPosition Both strands http://biohackathon.org/resource/faldo#StrandedPosition Stranded position http://biohackathon.org/resource/faldo#ForwardStrandPosition Positive strand http://biohackathon.org/resource/faldo#StrandedPosition Stranded position http://biohackathon.org/resource/faldo#ReverseStrandPosition Negative strand http://biohackathon.org/resource/faldo#StrandedPosition Stranded position http://purl.obolibrary.org/obo/GENO_0000833 genotype-phenotype association http://purl.org/oban/association association http://www.ncbi.nlm.nih.gov/gene/30269 danio rerio shha gene http://purl.obolibrary.org/obo/GENO_0000047 danio rerio gene http://www.ncbi.nlm.nih.gov/gene/399483 danio rerio cdkn1ca gene http://purl.obolibrary.org/obo/GENO_0000047 danio rerio gene http://www.ncbi.nlm.nih.gov/gene/6469 homo sapiens SHH gene http://purl.obolibrary.org/obo/GENO_0000054 homo sapiens gene http://www.ncbi.nlm.nih.gov/gene/20423 mus musculus shh gene http://purl.obolibrary.org/obo/GENO_0000057 mus musculus gene http://purl.obolibrary.org/obo/GENO_0000118 mus musculus strain http://purl.obolibrary.org/obo/GENO_0000112 strain or breed http://purl.obolibrary.org/obo/GENO_0000119 danio rerio strain http://purl.obolibrary.org/obo/GENO_0000112 strain or breed http://purl.obolibrary.org/obo/GENO_0000887 oryzias latipes strain http://purl.obolibrary.org/obo/GENO_0000112 strain or breed http://purl.obolibrary.org/obo/GENO_0000604 hemizygous X-linked http://purl.obolibrary.org/obo/GENO_0000134 hemizygous http://purl.obolibrary.org/obo/GENO_0000605 hemizygous Y-linked http://purl.obolibrary.org/obo/GENO_0000134 hemizygous http://purl.obolibrary.org/obo/GENO_0000606 hemizygous insertion-linked http://purl.obolibrary.org/obo/GENO_0000134 hemizygous http://purl.obolibrary.org/obo/GENO_0000458 simple heterozygous http://purl.obolibrary.org/obo/GENO_0000135 heterozygous http://purl.obolibrary.org/obo/GENO_0000139 heritable http://purl.obolibrary.org/obo/GENO_0000138 heritabililty http://purl.obolibrary.org/obo/GENO_0000140 non-heritable http://purl.obolibrary.org/obo/GENO_0000138 heritabililty http://purl.obolibrary.org/obo/UBERON_0000105 life cycle stage http://purl.obolibrary.org/obo/GENO_0000351 biological process http://purl.obolibrary.org/obo/GENO_0000770 phenotypic inheritance process http://purl.obolibrary.org/obo/GENO_0000351 biological process http://purl.obolibrary.org/obo/HsapDv_0000000 human life cycle stage http://purl.obolibrary.org/obo/GENO_0000351 biological process http://purl.obolibrary.org/obo/GENO_0000393 trisomic homozygous http://purl.obolibrary.org/obo/GENO_0000392 aneusomic zygosity http://purl.obolibrary.org/obo/GENO_0000394 trisomic heterozygous http://purl.obolibrary.org/obo/GENO_0000392 aneusomic zygosity http://purl.obolibrary.org/obo/GENO_0000839 knockdown reagent targeted gene complement http://purl.obolibrary.org/obo/GENO_0000527 reagent-targeted gene complement http://purl.obolibrary.org/obo/SO_0000337 RNAi_reagent http://purl.obolibrary.org/obo/GENO_0000533 gene knockdown reagent http://purl.obolibrary.org/obo/GENO_0000719 intrinsic genotype http://purl.obolibrary.org/obo/GENO_0000536 genotype http://purl.obolibrary.org/obo/ZP_0000199 abnormal(ly) malformed endocardium cell http://purl.obolibrary.org/obo/GENO_0000575 zebrafish phenotype http://purl.obolibrary.org/obo/ZP_0000386 abnormal(ly) absent dorso-rostral cluster http://purl.obolibrary.org/obo/GENO_0000575 zebrafish phenotype http://purl.obolibrary.org/obo/ZP_0000755 abnormal(ly) disrupted diencephalon development http://purl.obolibrary.org/obo/GENO_0000575 zebrafish phenotype http://purl.obolibrary.org/obo/ZP_0005531 abnormal(ly) disrupted neutrophil aggregation http://purl.obolibrary.org/obo/GENO_0000575 zebrafish phenotype http://purl.obolibrary.org/obo/ZP_0005692 abnormal(ly) absent adaxial cell http://purl.obolibrary.org/obo/GENO_0000575 zebrafish phenotype http://purl.obolibrary.org/obo/GENO_0000619 gpos http://purl.obolibrary.org/obo/GENO_0000618 chromosomal band intensity http://purl.obolibrary.org/obo/GENO_0000620 gneg http://purl.obolibrary.org/obo/GENO_0000618 chromosomal band intensity http://purl.obolibrary.org/obo/GENO_0000621 gvar http://purl.obolibrary.org/obo/GENO_0000618 chromosomal band intensity http://purl.obolibrary.org/obo/GENO_0000622 gpos100 http://purl.obolibrary.org/obo/GENO_0000619 gpos http://purl.obolibrary.org/obo/GENO_0000623 gpos75 http://purl.obolibrary.org/obo/GENO_0000619 gpos http://purl.obolibrary.org/obo/GENO_0000624 gpos50 http://purl.obolibrary.org/obo/GENO_0000619 gpos http://purl.obolibrary.org/obo/GENO_0000625 gpos25 http://purl.obolibrary.org/obo/GENO_0000619 gpos http://purl.obolibrary.org/obo/GENO_0000632 gpos66 http://purl.obolibrary.org/obo/GENO_0000619 gpos http://purl.obolibrary.org/obo/GENO_0000633 gpos33 http://purl.obolibrary.org/obo/GENO_0000619 gpos http://purl.obolibrary.org/obo/GENO_0000912 selectable marker region http://purl.obolibrary.org/obo/GENO_0000638 expressed transgene region http://purl.obolibrary.org/obo/GENO_0000640 reporter region http://purl.obolibrary.org/obo/GENO_0000638 expressed transgene region http://purl.obolibrary.org/obo/GENO_0000720 DNA sequence http://purl.obolibrary.org/obo/GENO_0000702 biological sequence http://purl.obolibrary.org/obo/GENO_0000721 RNA sequence http://purl.obolibrary.org/obo/GENO_0000702 biological sequence http://purl.obolibrary.org/obo/GENO_0000722 amino acid sequence http://purl.obolibrary.org/obo/GENO_0000702 biological sequence http://purl.obolibrary.org/obo/GENO_0000782 amino acid residue http://purl.obolibrary.org/obo/GENO_0000779 biological sequence unit http://purl.obolibrary.org/obo/GENO_0000910 reporter http://purl.obolibrary.org/obo/GENO_0000788 sequence feature attribute http://purl.obolibrary.org/obo/GENO_0000911 selectable marker http://purl.obolibrary.org/obo/GENO_0000788 sequence feature attribute http://purl.obolibrary.org/obo/SO_0000281 engineered_foreign_gene http://purl.obolibrary.org/obo/SO_0000704 gene http://purl.obolibrary.org/obo/HP_0000118 human phenotypic abnormality http://purl.obolibrary.org/obo/UPHENO_0001001 Phenotype http://purl.obolibrary.org/obo/GENO_0000575 zebrafish phenotype http://purl.obolibrary.org/obo/UPHENO_0001001 Phenotype http://purl.obolibrary.org/obo/MP_0000001 mammalian phenotype http://purl.obolibrary.org/obo/UPHENO_0001001 Phenotype http://purl.obolibrary.org/obo/GENO_0000113 taxonomic group http://purl.obolibrary.org/obo/PCO_0000000 collection of organisms http://purl.obolibrary.org/obo/GENO_0000616 chromosome sub-band http://purl.obolibrary.org/obo/SO_0000830 chromosome part http://purl.obolibrary.org/obo/SO_0000577 centromere http://purl.obolibrary.org/obo/SO_0000830 chromosome part http://purl.obolibrary.org/obo/SO_0000165 enhancer http://purl.obolibrary.org/obo/SO_0005836 regulatory_region http://purl.obolibrary.org/obo/SO_0000699 junction http://purl.obolibrary.org/obo/SO_0000110 sequence_feature http://purl.obolibrary.org/obo/GENO_0000964 mosaic http://purl.obolibrary.org/obo/GENO_0000928 clonal http://purl.obolibrary.org/obo/GENO_0000092 gene trap insertion http://purl.obolibrary.org/obo/SO_0000667 insertion http://purl.obolibrary.org/obo/SO_0001785 structural_alteration http://purl.obolibrary.org/obo/SO_0001059 sequence_alteration http://purl.obolibrary.org/obo/GENO_0000874 repeat region alteration http://purl.obolibrary.org/obo/SO_0001059 sequence_alteration http://purl.obolibrary.org/obo/IAO_8000016 taxonomic bridge ontology module http://purl.obolibrary.org/obo/IAO_8000004 bridge ontology module http://purl.obolibrary.org/obo/IAO_8000019 ontology module subsetted by OWL profile http://purl.obolibrary.org/obo/IAO_8000017 ontology module subsetted by expressivity http://purl.obolibrary.org/obo/IAO_8000020 EL++ ontology module http://purl.obolibrary.org/obo/IAO_8000019 ontology module subsetted by OWL profile http://purl.obolibrary.org/obo/GENO_0000873 microsatellite alteration http://purl.obolibrary.org/obo/GENO_0000874 repeat region alteration http://purl.obolibrary.org/obo/GENO_0000022 obsolete genomic feature collection genomic feature collection A sequence feature collection comprised of discontiguous sequences from a single genome http://purl.obolibrary.org/obo/GENO_0000029 obsolete reference single locus complement reference single locus feature complement A single locus complement that serves as a standard against which 'variant' sequences are compared http://purl.obolibrary.org/obo/GENO_0000042 obsolete reference junction hemizygous reference junction A junction found at a chromosomal position where an insertion has occurred on the homologous chromosome, such that the junction represents the reference feature paired with the hemizygously inserted feature. http://purl.obolibrary.org/obo/GENO_0000060 obsolete reference gene allele reference gene A version/allele of a gene that serves as a standard against which variant genes are compared. http://purl.obolibrary.org/obo/GENO_0000415 obsolete reagent sequence feature extra-genomic sequence A sequence feature that references some biological macromolecule applied as a reagent in an experiment or technique (e.g. a morpholino expression plasmid, or oligonucleotide probe) http://purl.obolibrary.org/obo/GENO_0000768 obsolete genomic position genomic coordinates A sequence feature position based on a genomic coordinate system, where the position specifies start and end coordinates based on its alignment with some reference genomic sequence. http://purl.obolibrary.org/obo/GENO_0000923 obsolete functional copy number complement functional feature complement A set of all features representing *functional* versions of a specified sequence (typically that of a gene) in a particular genome. http://purl.obolibrary.org/obo/GENO_0000883 obsolete gametic germ-line a quality inhering in a feature in virtue of its presence only in the genome of gametes (germ cells). http://purl.obolibrary.org/obo/GENO_0000955 obsolete variant copy number complement copy number variation A copy number complement' that has an abnormal number of members (e.g. more or less than two for an autosomal sequence in a diploid genome, as a result of deletion or duplication event(s). http://purl.obolibrary.org/obo/GENO_0000915 obsolete haplotype A haplotype is an allele that represents one of many possible versions of a 'haplotype block', which defines a region of genomic sequence that is typically 'co-inherited' across generations due to a lack of historically observed recombination within it. http://purl.obolibrary.org/obo/GENO_0000916 obsolete haplotype block A sequence feature representing a region of the genome over which there is little evidence for historical recombination, such that sequences it contain are typically co-inherited/transmitted across generations. http://purl.obolibrary.org/obo/SO_0000149 obsolete contig A contiguous sequence derived from sequence assembly. Has no gaps, but may contain N's from unavailable bases. http://purl.obolibrary.org/obo/GENO_0000019 obsolete sequence feature collection a collection more than one sequence features (ie a collection of discontinuous sequence features) http://purl.obolibrary.org/obo/GENO_0000037 obsolete unspecified feature A genomic feature known to exist, but remaining uncharacterized with respect to its identity (e.g. which allele exists at a given gene locus). http://purl.obolibrary.org/obo/GENO_0000125 obsolete sequence feature collection attribute sequence attribute that can inhere only in a collection of more than one sequence features http://purl.obolibrary.org/obo/GENO_0000142 obsolete dominant inheritance disposition inhering in a genetic locus variant that is realized in its inheritance by some offspring such that at least a partial variant-associated phenotype is apparent in heterozygotes http://purl.obolibrary.org/obo/GENO_0000324 obsolete chromosome complement A single locus complement that represents the collection of all chromosome sequences for a given chromosome in a single genome http://purl.obolibrary.org/obo/GENO_0000491 obsolete mutant allele An allele that is variant with respect to some wild-type allele, in virtue of its being very rare in a population (typically <1%), or being an experimentally-induced alteration that derives from a wild-type feature in a given strain. http://purl.obolibrary.org/obo/GENO_0000680 obsolete null feature A genomic feature that has an extent of zero. http://purl.obolibrary.org/obo/GENO_0000772 obsolete unspecified A sequence attribute inhering in a feature whose identity is not specified. http://purl.obolibrary.org/obo/GENO_0000778 obsolete sequence information entity An information entity that is intented to represent some biological sequence, sequence feature, qualified sequence feature, or a collection of one or more of these entities. http://purl.obolibrary.org/obo/GENO_0000848 obsolete coding sequence alteration A sequence alteration within the coding sequence of a gene. http://purl.obolibrary.org/obo/SO_0000143 obsolete assembly_component A region of known length which may be used to manufacture a longer region. http://purl.obolibrary.org/obo/GENO_0000890 obsolete canonical allele One of a set of sequence features or haplotypes that exist at a particular genetic locus. http://purl.obolibrary.org/obo/GENO_0000891 obsolete contextual allele An informational artifact that describes a canonical allele by defining its sequence and position relative to a particular reference sequence. http://purl.obolibrary.org/obo/SO_0001410 obsolete experimental_feature A region which is the result of some arbitrary experimental procedure. The procedure may be carried out with biological material or inside a computer. http://purl.obolibrary.org/obo/GENO_0000870 obsolete sequence feature collection A collection of more than one sequence feature. http://purl.obolibrary.org/obo/GENO_0000924 obsolete intrinsic sequence feature attribute A sequence feature attribute that reflects feature-level characteristics that depend only on the sequence, location, or genomic context of a feature or collection, but are independent of how it may be concretized in physical form. http://purl.obolibrary.org/obo/GENO_0000925 obsolete extrinsic sequence feature attribute A sequence feature attribute that reflects characteristics of the physical molecule in which the feature is concretized (e.g. its cellular context, source of origin, etc.) http://purl.obolibrary.org/obo/GENO_0000956 obsolete copy number complement A set of all features in a particular genome whose sequence aligns with a particular location on a reference genome. Such features are typically on the scale of complete genes or larger. http://purl.obolibrary.org/obo/GENO_0000901 obsolete allele cellular context A quality inhering in a particular allele in virtue of its presence only in a particular type of cell in an organism (e.g. somatic vs germ cells) http://purl.obolibrary.org/obo/PATO_0000016 obsolete color brightness color value http://purl.obolibrary.org/obo/GENO_0000876 obsolete genetic dosage an attribute inhering in a feature based on the total number or relative stoichiometry of functional copies present in a particular genome. http://purl.obolibrary.org/obo/BFO_0000001 entity http://purl.obolibrary.org/obo/GENO_0000091 obsolete experimental insertion http://purl.obolibrary.org/obo/GENO_0000150 obsolete autosomal recessive inheritance http://purl.obolibrary.org/obo/GENO_0000164 obsolete genetic insertion technique http://purl.obolibrary.org/obo/GENO_0000165 obsolete mutagen treatment technique http://purl.obolibrary.org/obo/GENO_0000166 obsolete targeted gene mutation technique http://purl.obolibrary.org/obo/GENO_0000169 obsolete random genetic insertion technique http://purl.obolibrary.org/obo/GENO_0000170 obsolete targeted genetic insertion technique http://purl.obolibrary.org/obo/GENO_0000171 obsolete enhancer trapping technique http://purl.obolibrary.org/obo/GENO_0000172 obsolete gene trapping technique http://purl.obolibrary.org/obo/GENO_0000173 obsolete promoter trapping technique http://purl.obolibrary.org/obo/GENO_0000174 obsolete targeted knock-in technique http://purl.obolibrary.org/obo/GENO_0000175 obsolete random transgene insertion technique http://purl.obolibrary.org/obo/GENO_0000724 obsolete biological sequence or collection http://purl.obolibrary.org/obo/GENO_0000725 obsolete biological sequence collection http://purl.obolibrary.org/obo/SO_0000637 obsolete engineered_plasmid http://purl.obolibrary.org/obo/GENO_0000385 has_reference_part http://purl.obolibrary.org/obo/GENO_0000654 has_sequence_part has_reference_sequence_part A relation between a sequence entity (i.e. a sequence, feature, or qualified feature) and a part of this entity that is not variant. http://purl.obolibrary.org/obo/GENO_0000408 is_allele_of http://purl.obolibrary.org/obo/GENO_0000418 has_affected_feature is_sequence_variant_of A relation linking an instance of a variable feature (aka an allele) to a genomic location/locus it occupies. This is typically a gene locus, but a feature may be an allele of other types of named loci such as QTLs, or alleles of some unnamed locus of arbitrary size. http://purl.obolibrary.org/obo/GENO_0000413 has_allele http://purl.obolibrary.org/obo/GENO_0000445 is_feature_affected_by has_sequence_variant A relation linking a gene class to one of its sequence-variant alleles. http://purl.obolibrary.org/obo/GENO_0000447 is_gene_target_of http://purl.obolibrary.org/obo/GENO_0000445 is_feature_affected_by is_target_of A relation between a gene class and a gene targeting reagent that targets it. http://purl.obolibrary.org/obo/GENO_0000449 has_expression_variant http://purl.obolibrary.org/obo/GENO_0000445 is_feature_affected_by has_expression_variant_instance A relation linking a gene class to one of an expression-variant of that gene.. http://purl.obolibrary.org/obo/RO_0003305 contributes to severity of condition http://purl.obolibrary.org/obo/RO_0003304 contributes to condition contributes to expressivity of condition A relationship between an entity (a genotype, genetic variation or environment) and a condition (a phenotype or disease) where the entity influences the severity with which a condition manifests in an individual. http://purl.obolibrary.org/obo/RO_0003306 contributes to frequency of condition http://purl.obolibrary.org/obo/RO_0003304 contributes to condition contributes to penetrance of condition A relationship between an entity (a genotype, genetic variation or environment) and a condition (a phenotype or disease) where the entity influences the frequency of the condition in a population. http://purl.obolibrary.org/obo/RO_0002234 has output http://purl.obolibrary.org/obo/RO_0000057 has participant p has output c iff c is a participant in p, c is present at the end of p, and c is not present at the beginning of p. http://purl.obolibrary.org/obo/IAO_0000219 denotes http://purl.obolibrary.org/obo/IAO_0000136 is about Denotes is a primitive, instance-level, relation obtaining between an information content entity and some portion of reality. Denotation is what happens when someone creates an information content entity E in order to specifically refer to something. The only relation between E and the thing is that E can be used to 'pick out' the thing. This relation connects those two together. Freedictionary.com sense 3: To signify directly; refer to specifically http://purl.obolibrary.org/obo/OBI_0000293 has_specified_input http://purl.obolibrary.org/obo/RO_0002233 has input A relation between a planned process and a continuant participating in that process that is not created during the process. The presence of the continuant during the process is explicitly specified in the plan specification which the process realizes the concretization of. http://purl.obolibrary.org/obo/OBI_0000299 has_specified_output http://purl.obolibrary.org/obo/RO_0002234 has output A relation between a planned process and a continuant participating in that process. The presence of the continuant at the end of the process is explicitly specified in the objective specification which the process realizes the concretization of. http://purl.obolibrary.org/obo/RO_0000086 has quality http://purl.obolibrary.org/obo/RO_0000053 bearer of a relation between an independent continuant (the bearer) and a quality, in which the quality specifically depends on the bearer for its existence http://purl.obolibrary.org/obo/RO_0002351 has member http://purl.obolibrary.org/obo/BFO_0000051 has part has member is a mereological relation between a collection and an item. http://purl.obolibrary.org/obo/RO_0003304 contributes to condition http://purl.obolibrary.org/obo/RO_0003302 causes or contributes to condition A relationship between an entity (a genotype, genetic variation or environment) and a condition (a phenotype or disease) where the entity has some contributing role in the manifestation of the condition. http://purl.obolibrary.org/obo/GENO_0000231 has_proper_part http://purl.obolibrary.org/obo/BFO_0000051 has part An antisymmetric, irreflexive (normally transitive) relation between a whole and a distinct part (source: SIO) http://purl.obolibrary.org/obo/GENO_0000248 is_proper_part_of http://purl.obolibrary.org/obo/BFO_0000050 is part of An asymmetric, irreflexive (normally transitive) relation between a part and its distinct whole. http://purl.obolibrary.org/obo/GENO_0000382 has_variant_part http://purl.obolibrary.org/obo/GENO_0000654 has_sequence_part A relation between a sequence entity (i.e. a sequence, feature, or qualified feature) and a part of this entity that is variant in terms of its sequence, position, or expression. http://purl.obolibrary.org/obo/GENO_0000414 targets_gene http://purl.obolibrary.org/obo/GENO_0000418 has_affected_feature A relation between a gene targeting reagent (e.g. a morpholino or RNAi) and the class of gene it targets. http://purl.obolibrary.org/obo/GENO_0000443 is_expression_variant_of http://purl.obolibrary.org/obo/GENO_0000418 has_affected_feature A relation between an expression-variant gene (ie integrated transgenes or knockdown reagent targeted genes), and the class of gene it represents. http://purl.obolibrary.org/obo/GENO_0000608 has_zygosity http://purl.obolibrary.org/obo/GENO_0000207 has_sequence_attribute a relation to link a single locus complement to its zygosity. http://purl.obolibrary.org/obo/GENO_0000610 is_reference_allele_of http://purl.obolibrary.org/obo/GENO_0000408 is_allele_of A relationship between a reference locus/allele and the gene class it is an allele of. http://purl.obolibrary.org/obo/GENO_0000641 is_variant_allele_of http://purl.obolibrary.org/obo/GENO_0000408 is_allele_of A relationship between a variant allele and the gene class it is an allele of. http://purl.obolibrary.org/obo/GENO_0000652 is_polymorphic_allele_of http://purl.obolibrary.org/obo/GENO_0000641 is_variant_allele_of A relationship between a polymorphic allele and the gene class it is an allele of. http://purl.obolibrary.org/obo/GENO_0000653 is_wild_type_allele_of http://purl.obolibrary.org/obo/GENO_0000408 is_allele_of A relationship between a wild-type allele and the gene class it is an allele of. http://purl.obolibrary.org/obo/GENO_0000654 has_sequence_part http://purl.obolibrary.org/obo/BFO_0000051 has part An organizational class to hold relations of parthood between sequences/features. http://purl.obolibrary.org/obo/GENO_0000661 is_sex_agnostic_part_of http://purl.obolibrary.org/obo/GENO_0000655 is_sequence_part_of Relationship between an intrinsic genotype and a sex-qualified genotype, created specifically to support propagation of phenotypes asserted on the latter to the former for Monarch Initiative use cases. http://purl.obolibrary.org/obo/GENO_0000783 has_sequence_unit http://purl.obolibrary.org/obo/GENO_0000654 has_sequence_part A relation between a nucleic acid or amino acid sequence or sequence feature, and one of its monomeric units (nucleotide or amino acid residues) http://purl.obolibrary.org/obo/GENO_0000784 completely_varies_with http://purl.obolibrary.org/obo/GENO_0000683 varies_with A relation between two seqeunces or features that are considered variant with each other along their entire extents. http://purl.obolibrary.org/obo/GENO_0000842 non-causal_for_condition http://purl.obolibrary.org/obo/GENO_0000790 related_condition Relation between an entity and a condition (disease, phenotype) which it does not cause or contribute to. http://purl.obolibrary.org/obo/GENO_0000846 has_qualifying_process http://purl.obolibrary.org/obo/GENO_0000580 has_qualifier A relation used to describe a process contextualizing the identity of an entity. http://purl.obolibrary.org/obo/GENO_0000847 has_qualifying_environment http://purl.obolibrary.org/obo/GENO_0000580 has_qualifier A relation used to describe an environment contextualizing the identity of an entity. http://purl.obolibrary.org/obo/RO_0002524 has subsequence http://purl.obolibrary.org/obo/GENO_0000654 has_sequence_part x has subsequence y iff all of the sequence parts of x are sequence parts of y http://purl.obolibrary.org/obo/RO_0003302 causes or contributes to condition http://purl.obolibrary.org/obo/GENO_0000790 related_condition A relationship between an entity (a genotype, genetic variation or environment) and a condition (a phenotype or disease) where the entity has some causal or contributing role that influences the condition. http://purl.obolibrary.org/obo/RO_0003303 causes condition http://purl.obolibrary.org/obo/RO_0003302 causes or contributes to condition A relationship between an entity (a genotype, genetic variation or environment) and a condition (a phenotype or disease) where the entity has a causal role for the condition. http://purl.obolibrary.org/obo/RO_0003307 is preventative for condition http://purl.obolibrary.org/obo/GENO_0000790 related_condition A relationship between an entity (a genotype, genetic variation or environment) and a condition (a phenotype or disease) where the entity prevents or reduces the severity of a condition. http://purl.obolibrary.org/obo/RO_0003308 correlated with condition http://purl.obolibrary.org/obo/GENO_0000790 related_condition A relationship between an entity and a condition (phenotype or disease) with which it exhibits a statistical dependence relationship. http://biohackathon.org/resource/faldo#reference reference (faldo) http://purl.obolibrary.org/obo/GENO_0000708 faldo properties The reference is the resource that the position value is anchored to. For example, a contig or chromosome in a genome assembly. http://purl.obolibrary.org/obo/RO_0000091 has disposition http://purl.obolibrary.org/obo/RO_0000053 bearer of a relation between an independent continuant (the bearer) and a disposition, in which the disposition specifically depends on the bearer for its existence http://purl.obolibrary.org/obo/RO_0002233 has input http://purl.obolibrary.org/obo/RO_0000057 has participant p has direct input c iff c is a participant in p, c is present at the start of p, and the state of c is modified during p. http://purl.obolibrary.org/obo/GENO_0000968 sequence role http://purl.obolibrary.org/obo/RO_0000053 bearer of A role assigned to a sequence feature, collection, or genotype, e.g. serving as a 'reference' against with other sequences are compared. http://purl.obolibrary.org/obo/RO_0002522 bounds sequence of http://purl.obolibrary.org/obo/GENO_0000654 has_sequence_part x bounds the sequence of y iff the upstream-most part of x is upstream of or coincident with the upstream-most part of y, and the downstream-most part of x is downstream of or coincident with the downstream-most part of y http://purl.obolibrary.org/obo/RO_0002526 overlaps sequence of http://purl.obolibrary.org/obo/RO_0002131 overlaps x overlaps the sequence of x if and only if x has a subsequence z and z is a subsequence of y. http://purl.obolibrary.org/obo/GENO_0000626 has_staining_intensity http://purl.obolibrary.org/obo/GENO_0000207 has_sequence_attribute has_color_value http://purl.obolibrary.org/obo/RO_0000087 has role http://purl.obolibrary.org/obo/RO_0000053 bearer of http://purl.obolibrary.org/obo/RO_0002352 input of http://purl.obolibrary.org/obo/RO_0000056 participates in http://purl.obolibrary.org/obo/RO_0002353 output of http://purl.obolibrary.org/obo/RO_0000056 participates in http://purl.obolibrary.org/obo/GENO_0000740 has_inferred_phenotype http://purl.obolibrary.org/obo/RO_0002200 has phenotype http://purl.obolibrary.org/obo/GENO_0000743 has_asserted_phenotype http://purl.obolibrary.org/obo/RO_0002200 has phenotype http://purl.obolibrary.org/obo/GENO_0000651 is_mutant_allele_of http://purl.obolibrary.org/obo/GENO_0000641 is_variant_allele_of http://purl.obolibrary.org/obo/GENO_0000650 has_sex_agnostic_part http://purl.obolibrary.org/obo/GENO_0000654 has_sequence_part http://purl.obolibrary.org/obo/GENO_0000383 is_variant_part_of http://purl.obolibrary.org/obo/GENO_0000655 is_sequence_part_of http://purl.obolibrary.org/obo/GENO_0000387 is_reference_part_of http://purl.obolibrary.org/obo/GENO_0000655 is_sequence_part_of http://purl.obolibrary.org/obo/GENO_0000761 is_regulatory_part_of http://purl.obolibrary.org/obo/GENO_0000655 is_sequence_part_of http://purl.obolibrary.org/obo/RO_0002525 is subsequence of http://purl.obolibrary.org/obo/GENO_0000655 is_sequence_part_of http://biohackathon.org/resource/faldo#begin begin http://purl.obolibrary.org/obo/GENO_0000708 faldo properties http://biohackathon.org/resource/faldo#end end http://purl.obolibrary.org/obo/GENO_0000708 faldo properties http://biohackathon.org/resource/faldo#location location http://purl.obolibrary.org/obo/GENO_0000708 faldo properties http://purl.obolibrary.org/obo/GENO_0000791 inferred_to_cause_condition http://purl.obolibrary.org/obo/GENO_0000790 related_condition http://purl.obolibrary.org/obo/GENO_0000793 inferred_to_contribute_to_condition http://purl.obolibrary.org/obo/GENO_0000790 related_condition http://purl.obolibrary.org/obo/GENO_0000794 inferred_to_correlate_with_condition http://purl.obolibrary.org/obo/GENO_0000790 related_condition http://purl.obolibrary.org/obo/GENO_0000845 has_uncertain_significance_for_condition http://purl.obolibrary.org/obo/GENO_0000790 related_condition http://purl.obolibrary.org/obo/GENO_0000849 is_candidate_variant_for http://purl.obolibrary.org/obo/GENO_0000790 related_condition http://purl.obolibrary.org/obo/GENO_0000843 benign_for_condition http://purl.obolibrary.org/obo/GENO_0000842 non-causal_for_condition http://purl.obolibrary.org/obo/GENO_0000844 likely_benign_for_condition http://purl.obolibrary.org/obo/GENO_0000842 non-causal_for_condition http://purl.obolibrary.org/obo/GENO_0000840 pathogenic_for_condition http://purl.obolibrary.org/obo/RO_0003303 causes condition http://purl.obolibrary.org/obo/GENO_0000841 likely_pathogenic_for_condition http://purl.obolibrary.org/obo/RO_0003303 causes condition http://purl.obolibrary.org/obo/BFO_0000051 has part http://purl.obolibrary.org/obo/RO_0002131 overlaps http://purl.obolibrary.org/obo/BFO_0000050 is part of http://purl.obolibrary.org/obo/RO_0002131 overlaps http://purl.obolibrary.org/obo/RO_0002091 starts during http://purl.obolibrary.org/obo/RO_0002222 temporally related to http://purl.obolibrary.org/obo/RO_0002093 ends during http://purl.obolibrary.org/obo/RO_0002222 temporally related to http://purl.obolibrary.org/obo/RO_0002350 is member of http://purl.obolibrary.org/obo/BFO_0000050 is part of http://purl.obolibrary.org/obo/GENO_0000655 is_sequence_part_of http://purl.obolibrary.org/obo/BFO_0000050 is part of http://purl.obolibrary.org/obo/GENO_0000211 bears_concretization_of materializes A relation between a material information bearer or material genetic sequence bearer and generically dependent continuant that carries information or sequence content that the bearer encodes http://purl.obolibrary.org/obo/GENO_0000239 has_sequence has_state A relationship between an entity that carries a sequence (e.g. a sequence feature or collection), and the sequence it bears. http://purl.obolibrary.org/obo/GENO_0000359 obsolete_is_phenotype_of_genotype phenotype_has_genotype shortcut relation used to link a phenotype directly to a genotype of an organism http://purl.obolibrary.org/obo/GENO_0000410 obsolete_is_genetic_variant_of is_variant_instance_of A relation used to link a variant locus instance to the gene class it is a variant of (in terms of its sequence or expression level). http://purl.obolibrary.org/obo/GENO_0000411 obsolete_has_genetic_variant has_variant_instance A relation linking a gene class to a sequence-varaint or expression-variant of the gene. http://purl.obolibrary.org/obo/GENO_0000445 is_feature_affected_by class_to_feature_relation A relation between a genomic feature class (typically a gene class) and an instance of a sequence feature or qualified sequence feature that represents or affects some change in the sequence or expression of the genomic feature. http://purl.obolibrary.org/obo/GENO_0000580 has_qualifier has_qualifying_context A relation used to describe a context or conditions that define and/or identify an entity. http://purl.obolibrary.org/obo/GENO_0000726 has_sequence_feature has_sequence_feature_component A relation linking a qualified sequence feature to its component sequence feature. http://purl.obolibrary.org/obo/GENO_0000742 obsolete_is_alteration_within is_within_allele_of A relation linking a sequence_alteration to the gene it alters. http://purl.obolibrary.org/obo/GENO_0000917 has_member_count has_count Describes the number of members in some set. http://purl.obolibrary.org/obo/GENO_0000903 has_location occupies A relation linking a sequence feature to the location it occupies on some reference sequence. http://purl.obolibrary.org/obo/RO_0002162 in taxon x is in taxon y if an only if y is an organism, and the relationship between x and y is one of: part of (reflexive), developmentally preceded by, derives from, secreted by, expressed. http://purl.obolibrary.org/obo/IAO_0000136 is about is_about is a (currently) primitive relation that relates an information artifact to an entity. http://purl.obolibrary.org/obo/RO_0000052 inheres_in a relation between a specifically dependent continuant (the dependent) and an independent continuant (the bearer), in which the dependent specifically depends on the bearer for its existence http://purl.obolibrary.org/obo/RO_0000053 bearer of a relation between an independent continuant (the bearer) and a specifically dependent continuant (the dependent), in which the dependent specifically depends on the bearer for its existence http://purl.obolibrary.org/obo/RO_0000056 participates in a relation between a continuant and a process, in which the continuant is somehow involved in the process http://purl.obolibrary.org/obo/RO_0000057 has participant a relation between a process and a continuant, in which the continuant is somehow involved in the process http://purl.obolibrary.org/obo/RO_0000059 concretizes A relationship between a specifically dependent continuant and a generically dependent continuant, in which the generically dependent continuant depends on some independent continuant in virtue of the fact that the specifically dependent continuant also depends on that same independent continuant. Multiple specifically dependent continuants can concretize the same generically dependent continuant. http://purl.obolibrary.org/obo/RO_0002200 has phenotype A relationship that holds between a biological entity and a phenotype. Here a phenotype is construed broadly as any kind of quality of an organism part, a collection of these qualities, or a change in quality or qualities (e.g. abnormally increased temperature). The subject of this relationship can be an organism (where the organism has the phenotype, i.e. the qualities inhere in parts of this organism), a genomic entity such as a gene or genotype (if modifications of the gene or the genotype causes the phenotype), or a condition such as a disease (such that if the condition inheres in an organism, then the organism has the phenotype). http://purl.obolibrary.org/obo/GENO_0000207 has_sequence_attribute A relation used to link sequence entities (sequences, features, qualified features, and collections thereof) to their 'attributes'. http://purl.obolibrary.org/obo/GENO_0000222 has_genotype A relationship that holds between a biological entity and some level of genetic variation present in its genome. http://purl.obolibrary.org/obo/GENO_0000242 obsolete_specifies A relationship between an information content entity representing a specification, and the entity it specifies. http://purl.obolibrary.org/obo/GENO_0000368 obsolete_participates_in_inheritance_process A relation to link variant loci, phenotypes, or disease to the type of inheritance process they are involved in, based on how the genetic interactions between alleles at the causative locus determine the pattern of inheritance of a specific phenotype/disease from one generation to the next. http://purl.obolibrary.org/obo/GENO_0000418 has_affected_feature A relation that holds between an instance of a geneetic variation and a genomic feature (typically a gene class) that is affected in its sequence or expression. http://purl.obolibrary.org/obo/GENO_0000486 obsolete_is_variant_with A relation between two sequence features at a given genomic locus that vary in their sequence or level of expression. http://purl.obolibrary.org/obo/GENO_0000488 obsolete_is_expression_variant_with A relation between two instances of a given gene that vary in their level of expression as a result of external factors influencing expression (e.g. gnee-knockdown reagents, epigenetic modification, alteration of endogenous gene-regulation pathways). http://purl.obolibrary.org/obo/GENO_0000634 is_targeted_by relation between an molecular agent and its molecular target http://purl.obolibrary.org/obo/GENO_0000639 sequence_derives_from Relationship between a sequence feature and a distinct, non-overlapping feature from which it derives part or all of its sequence. http://purl.obolibrary.org/obo/GENO_0000678 has_extent Property linking a sequence or sequence feature to an integer representing its length in terms of the number of units in the sequence. http://purl.obolibrary.org/obo/GENO_0000683 varies_with A relation that holds between two sequence features at a particular genomic location that vary in their sequence. These features will have the same position when mapped onto a reference sequence, but vary in their sequence (in whole or in part). http://purl.obolibrary.org/obo/GENO_0000703 has_sequence_string Shortcut relation linking a sequence feature directly to a string representing the 'state' of its sequence - i.e. the ordering of units that comprise it (e.g. 'atgcagctagctaccgtcgatcg'). http://purl.obolibrary.org/obo/GENO_0000767 obsolete_has_position_component A relation linking a sequence feature to its component Position that represents an identifying criteria for sequence feature instances. http://purl.obolibrary.org/obo/GENO_0000866 has_quantifier Property to link an assertion or association with some value quantifying its relevance or ranking. http://purl.obolibrary.org/obo/RO_0003301 is model of Relation between a research artifact and an entity it is used to study, in virtue of its replicating or approximating features of the studied entity. http://purl.obolibrary.org/obo/GENO_0000894 start_position The starting position of a sequence feature or interval. http://purl.obolibrary.org/obo/GENO_0000895 end_position The ending position of a sequence feature or interval. http://purl.obolibrary.org/obo/RO_0002131 overlaps x overlaps y if and only if there exists some z such that x has part z and z part of y http://purl.obolibrary.org/obo/RO_000244 molecularly controls Holds between molecular entities a and b when the execution of a activates or inhibits the activity of b http://purl.obolibrary.org/obo/GENO_0000896 has_string Property linking a biological sequence to a string representing the ordered units that comprise the sequence (e.g. 'atgcagctagctaccgtcgatcg'). http://purl.obolibrary.org/obo/GENO_0000957 has_defining_location Holds between a copy number complement or functional copy number complement, and a genomic location that serves as a proxy for the sequence or functional element that defines the complement. http://purl.obolibrary.org/obo/GENO_0000958 has_defining_sequence Holds between a copy number complement or functional copy number complement, and the biological sequence that defines the complement. http://purl.obolibrary.org/obo/GENO_0000959 has_defining_feature Holds between a copy number complement or functional copy number complement and a genomic feature that serves as a proxy for the sequence that defines the complement. http://purl.obolibrary.org/obo/RO_0002528 is upstream of sequence of inverse of downstream of sequence of http://purl.obolibrary.org/obo/RO_0002529 is downstream of sequence of x is downstream of the sequence of y iff either (1) x and y have sequence units, and all units of x are downstream of all units of y, or (2) x and y are sequence units, and x is either immediately downstream of y, or transitively downstream of y. http://purl.obolibrary.org/obo/GENO_0000966 has_interval Relates a sequence feature location to an interval that defines its start and end position. http://purl.obolibrary.org/obo/GENO_0000967 has_reference_sequence Relates a 'sequence feature location' to a sequence that it is anchored to. http://purl.obolibrary.org/obo/GENO_0000906 on strand http://purl.obolibrary.org/obo/RO_0001000 derives from http://biohackathon.org/resource/faldo#position position http://purl.org/oban/association_has_object association has object http://purl.org/oban/association_has_predicate association has predicate http://purl.org/oban/association_has_subject association has subject http://purl.obolibrary.org/obo/GENO_0000220 is_genotype_of http://purl.obolibrary.org/obo/GENO_0000243 obsolete_approximates_sequence http://purl.obolibrary.org/obo/GENO_0000244 obsolete_resolves_to_sequence http://purl.obolibrary.org/obo/GENO_0000251 is_sequence_of http://purl.obolibrary.org/obo/GENO_0000252 is_subject_of http://purl.obolibrary.org/obo/GENO_0000253 obsolete_is_specified_by http://purl.obolibrary.org/obo/GENO_0000708 faldo properties http://purl.obolibrary.org/obo/GENO_0000712 ObsoleteDataProperty http://purl.obolibrary.org/obo/GENO_0000741 obsolete_has_regulatory_part http://purl.obolibrary.org/obo/GENO_0000790 related_condition http://purl.obolibrary.org/obo/RO_0002222 temporally related to http://purl.obolibrary.org/obo/RO_0002354 obsolete_formed as result of http://purl.obolibrary.org/obo/RO_0002201 phenotype of